Detail-Interactions: | |
RAID ID: | RRI00003055 |
---|---|
RNA/Protein Symbol 1: | MIR23A(miR-23a) |
RNA/Protein Category 1: | miRNA |
RNA/Protein Symbol 2: | MYH1 mRNA(Myh 1) |
RNA/Protein Category 2: | mRNA |
Validated Method: | Luciferase reporter assay |
Tissue: | |
PMID: | 22771720 |
Detail description: | Using bioinformatics analyses, miR-23a is predicted to target multiple adult fast myosin heavy chain (Myh) genes, including Myh 1, 2 and 4. Luciferase reporter assays show that miR-23a directly targets the 3' untranslated regions (UTRs) of these mRNAs. |
The Predicated Binding Sites between MIR23A and MYH1 | |||||
By miRanda | Structure | Match Score | Energy Score | MIR23A Location | MYH1 Location |
The Predicated Binding Sites between MIR23A and MYH1 | ||||
By RIsearch | Structure | MIR23A Location | MYH1 Location | Score |
Query: 3' GGGUU---CCUGGGGA---UGGGAUUU 5' ::|| |||:| ::||||| Target: 5' UUCAUGUUUUACCUCACUGUUUCUAAA 3' |
2-22 | 47-73 | -9.13 | |
The Predicated Binding Sites of MYH1 | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.