Detail-Interactions: | |
RAID ID: | RRI00003050 |
---|---|
RNA/Protein Symbol 1: | MIR222(miR-222) |
RNA/Protein Category 1: | miRNA |
RNA/Protein Symbol 2: | SNTB1 mRNA |
RNA/Protein Category 2: | mRNA |
Validated Method: | |
Tissue: | |
PMID: | 20856896 |
Detail description: | Among the possible microRNAs (miRs) found to be upregulated in the skeletal muscle tissue of mdx compared to wt mice, we demonstrated that miR-222 specifically binds to the 3'-UTR of ¦Â1-syntrophin and participates in the downregulation of ¦Â1-syntrophin. |
The Predicated Binding Sites between MIR222 and SNTB1 | |||||
By miRanda | Structure | Match Score | Energy Score | MIR222 Location | SNTB1 Location |
Query: 3' ucCUAGAUGUGACC----GAUGACUc 5' |:|:| || ||| :|||||| Ref: 5' auGGUUUUCAGUGGCAACUUACUGAc 3' |
139.00 | -17.55 | 2-21 | 907-932 | |
Query: 3' uccUAGAU-GUGACCGAUGACUc 5' || || ||| :|||||| Ref: 5' auuAUAUAGCAC--AUUACUGAu 3' |
131.00 | -10.07 | 2-20 | 1130-1150 | |
Query: 3' uccuagaUGUGACCGAUGACUc 5' |||| |||:||| Ref: 5' aaaaauaACAC---CUAUUGAu 3' |
127.00 | -9.58 | 2-16 | 1189-1207 |
The Predicated Binding Sites between MIR222 and SNTB1 | ||||
By RIsearch | Structure | MIR222 Location | SNTB1 Location | Score |
Query: 3' CUCAGUA---GCCAGUG-------UAGAUC 5' ||||| :||||: :||||| Target: 5' GAGUCUAAGAUGGUCGAAUGUCGAGUCUAG 3' |
1-20 | 654-683 | -18.17 |
The Predicated Binding Sites of SNTB1 | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.