Detail-Interactions: | |
RAID ID: | RRI00000117 |
---|---|
RNA/Protein Symbol 1: | HOTAIR |
RNA/Protein Category 1: | lncRNA |
RNA/Protein Symbol 2: | HOXD11 mRNA |
RNA/Protein Category 2: | mRNA |
Validated Method: | |
Tissue: | |
PMID: | 17604716 |
Detail description: | In this issue, Rinn et al. (2007) characterize noncoding RNAs that regulate HOX genes and discover one, HOTAIR, that unexpectedly regulates a HOX gene cluster on a different chromosome than the HOX cluster that encodes it. |
The Predicated Binding Sites between HOTAIR and HOXD11 | |||||
By miRanda | Structure | Match Score | Energy Score | HOTAIR Location | HOXD11 Location |
The Predicated Binding Sites between HOTAIR and HOXD11 | ||||
By RIsearch | Structure | HOTAIR Location | HOXD11 Location | Score |
Query: 3' UUGCACUCUAAAUAUAGACCCCAGCUUGGGACAAAAGUUG 5' :||| |||| || :||:| |||||:| Target: 5' GACGCGAGAC--------CGGCGUGAGCA---GUUUCAGC 3' |
1819-1858 | 6-34 | -16.38 | |
The Predicated Binding Sites of HOXD11 | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.