Detail-Interactions: | |
RAID ID: | RRI00000105 |
---|---|
RNA/Protein Symbol 1: | PEG3-AS1(APeg3) |
RNA/Protein Category 1: | lncRNA |
RNA/Protein Symbol 2: | PEG3 mRNA(Peg3) |
RNA/Protein Category 2: | mRNA |
Validated Method: | |
Tissue: | |
PMID: | 15950772 |
Detail description: | We report here the robust expression in the VP-MCNs of an RNA, which we designate APeg3 that is transcribed in the antisense direction to the 3` untranslated region of the Peg3 gene. |
The Predicated Binding Sites between PEG3-AS1 and PEG3 | |||||
By miRanda | Structure | Match Score | Energy Score | PEG3-AS1 Location | PEG3 Location |
The Predicated Binding Sites between PEG3-AS1 and PEG3 | ||||
By RIsearch | Structure | PEG3-AS1 Location | PEG3 Location | Score |
Query: 3' UACUUCUCAUCAGCUUGAUUGGCACCACCUGUGCUGGUGC 5' |||||||||||||||||||||||||||||||||||||||| Target: 5' AUGAAGAGUAGUCGAACUAACCGUGGUGGACACGACCACG 3' |
1275-1314 | 4653-4692 | -82.66 | |
The Predicated Binding Sites of PEG3 | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.