Detail-Interactions: | |
RAID ID: | RRI00000094 |
---|---|
RNA/Protein Symbol 1: | EMX2OS |
RNA/Protein Category 1: | lncRNA |
RNA/Protein Symbol 2: | EMX2 mRNA |
RNA/Protein Category 2: | mRNA |
Validated Method: | |
Tissue: | |
PMID: | 12573261 |
Detail description: | Conservation of functional human and murine EMX2 antisense genes, of overlap between the sense and the antisense transcripts, and of identical cellular expression patterns suggests a biological function for EMX2OS, presumably to regulate EMX2. |
The Predicated Binding Sites between EMX2OS and EMX2 | |||||
By miRanda | Structure | Match Score | Energy Score | EMX2OS Location | EMX2 Location |
The Predicated Binding Sites between EMX2OS and EMX2 | ||||
By RIsearch | Structure | EMX2OS Location | EMX2 Location | Score |
Query: 3' CCCUUUUCCGCCCACCCCACUCUAUGCUGUCCACAGCCU 5' |||:|: | |||| | ||||| | |||: |||: Target: 5' GGGGAGC-GAGGGUCGAGUGAGCGAGGACGC--CGCGGG 3' |
6338-6376 | 2-37 | -28.08 | |
The Predicated Binding Sites of EMX2 | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.