The Detail Information for This Interaction


  • Detail
  • Binding
  • Network
Detail-Interactions:
RAID ID: RRI00000056
RNA/Protein Symbol 1:POU5F1P4(OCT4-pg4)
RNA/Protein Category 1: lncRNA
RNA/Protein Symbol 2: MIR145(miR-145)
RNA/Protein Category 2: miRNA
Validated Method:
Tissue: Hepatocellular carcinoma cells 
PMID: 23615404 
Detail description:

The expression level of OCT4-pg4 is positively correlated with that of OCT4, and both gene transcripts can be directly targeted by a tumor-suppressive micro RNA miR-145. 

The Predicated Binding Sites between MIR145 and POU5F1P4
By miRanda Structure Match Score Energy Score MIR145 Location POU5F1P4 Location 
   Query:    3' uccCUAAGGACCCUUUUGACCUg 5'
                   |:| ||  | :|||||||| 
   Ref:      5' ccuGGUGCC--GUGAAACUGGAg 3'
153.00 -18.53 2-21 356-376 
   Query:    3' ucccuaaggaCCCUUUUGACCUg 5'
                          || :||:||||| 
   Ref:      5' aacuggagaaGGAGAAGCUGGAg 3'
137.00 -17.21 2-14 369-391 
   Query:    3' ucccuaaggacCCUUUUGACCUg 5'
                           || || ||||| 
   Ref:      5' accgagugagaGGCAACCUGGAg 3'
120.00 -13.02 2-13 717-739
The Predicated Binding Sites between MIR145 and POU5F1P4
By RIsearch Structure MIR145 Location POU5F1P4 Location Score 
Query:    3' UUUUCCCA---GGAAUCCCU 5'
          ::||||||   :|||:|||:
Target:   5' GGAAGGGUUUAUCUUGGGGG 3'
7-23 514-533 -21.01
The Predicated Binding Sites of POU5F1P4
RBPBD 

					

					

						RsiteDB
						
					

						BindN
						
							 

								
					

					

						BindN+
						
							 

								
					

					

					    RNAbindR
						
                              
	 
								
					

					

					    Pprint
						
                            

								
					



				 
	
            			
	

	
    
	
	  
	 

      

	  
Visualization:
	  
	  

	  Select the center nodes:
	   First Node
	   Second Node
	  Both the Nodes	
 
      
Select the Level of Neighbour:
	   First Neighbour
	   Second Neighbour  
	  

	        
	  

	 
	 
	


 
	 

	  The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
	  the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes. 
	  
The 'First Neighbour' represents the sub-network of direct interacting with the center node, 
	  the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node. 
	  Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
	 


	  

	   
	
	

  





	

		

           			
				
	
                   The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
 
				   The Binding page: representing the predicted binding sites and/or constants.
 
				   The Network page: representing the interaction sub-network of interacting RNA/Protein.