The Detail Information for This Interaction


  • Detail
  • Binding
  • Network
Detail-Interactions:
RAID ID: RRI00000047
RNA/Protein Symbol 1:PTENP1
RNA/Protein Category 1: lncRNA
RNA/Protein Symbol 2: MIR21(miR-21)
RNA/Protein Category 2: miRNA
Validated Method: Dual Luciferase reporter assay, RT-PCR, Western blot
Tissue:  
PMID: 20577206 
Detail description:

Within the high homology region, we found perfectly conserved seed matches for the PTEN-targeting miR-17, miR-21, miR-214, miR-19 and miR-26 families (Fig. 1c, Supplementary Fig. 1). To measure the role of these microRNAs on both PTEN and PTENP1 expression, we designed specific PCR primer sets in the non-homologous 3?¡¥UTR regions (Supplementary Fig. 2a,b). In DU145 prostate cancer cells, PTEN-targeting microRNAs miR-19b and miR-20a suppress both PTEN and PTENP1 mRNA abundance (Fig. 1d, Supplementary Fig. 3a). In these cells, a pool of inhibitors of endogenously expressed PTEN-targeting microRNAs (Supplementary Fig. 3b) de-repressed both PTEN and PTENP1 transcript levels (Fig. 1e). The use of chimeric luciferase plasmids indicated the microRNA:PTENP1 interaction was direct (Supplementary Fig. 4a¡§Cc). 

The Predicated Binding Sites between MIR21 and PTENP1
By miRanda Structure Match Score Energy Score MIR21 Location PTENP1 Location 
   Query:    3' aguuguagucaGACUAUUCGAu 5'
                           | ||||||:| 
   Ref:      5' acuuguggcaaCAGAUAAGUUu 3'
131.00 -11.79 2-12 2395-2416 
   Query:    3' aguuGUAGUCAGACUAUUCgau 5'
                    |||   |||||||||   
   Ref:      5' aaguCAUGUAUCUGAUAAGgga 3'
126.00 -13.27 4-19 3495-3516 
   Query:    3' aguuguagucagacUAUUCGau 5'
                              ||||||  
   Ref:      5' uauaggaauaaccaAUAAGCaa 3'
120.00 -5.06 3-9 3595-3616
The Predicated Binding Sites between MIR21 and PTENP1
By RIsearch Structure MIR21 Location PTENP1 Location Score 
Query:    3' UAGCUU--AUCAGACUG--AUGUUG 5'
          |||||     ||:|||    |||||
Target:   5' AUCGAUUGACGUUUGAAUAGACAAC 3'
1-21 2403-2427 -14.48
The Predicated Binding Sites of PTENP1
RBPBD 

					

					

						RsiteDB
						
					

						BindN
						
							 

								
					

					

						BindN+
						
							 

								
					

					

					    RNAbindR
						
                              
	 
								
					

					

					    Pprint
						
                            

								
					



				 
	
            			
	

	
    
	
	  
	 

      

	  
Visualization:
	  
	  

	  Select the center nodes:
	   First Node
	   Second Node
	  Both the Nodes	
 
      
Select the Level of Neighbour:
	   First Neighbour
	   Second Neighbour  
	  

	        
	  

	 
	 
	


 
	 

	  The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
	  the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes. 
	  
The 'First Neighbour' represents the sub-network of direct interacting with the center node, 
	  the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node. 
	  Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
	 


	  

	   
	
	

  





	

		

           			
				
	
                   The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
 
				   The Binding page: representing the predicted binding sites and/or constants.
 
				   The Network page: representing the interaction sub-network of interacting RNA/Protein.