Detail-Interactions: | |
RAID ID: | RRI00000040 |
---|---|
RNA/Protein Symbol 1: | POU5F1P5(OCT4-pg5) |
RNA/Protein Category 1: | lncRNA |
RNA/Protein Symbol 2: | MIR145(miR-145) |
RNA/Protein Category 2: | miRNA |
Validated Method: | Dual Luciferase reporter assay, RT-PCR |
Tissue: | |
PMID: | 20577206 |
Detail description: | Alignments of gene and pseudogenes sequences show that microRNA-binding sites are well conserved; for example, the miR-145 binding site on OCT4 and its pseudogenes OCT4-pg1, 3, 4 and 5 (Supplementary Fig. 11a); miR-1 family binding sites on CONNEXIN 43 (CX43) and its pseudogene (Supplementary Fig. 11b). |
The Predicated Binding Sites between MIR145 and POU5F1P5 | |||||
By miRanda | Structure | Match Score | Energy Score | MIR145 Location | POU5F1P5 Location |
Query: 3' ucCCUAAGGACCCUUUUGACCug 5' ||| | :||||: |||||| Ref: 5' ggGGAGU-UUGGGGCAACUGGuu 3' |
147.00 | -28.11 | 3-22 | 919-940 | |
Query: 3' ucccuaaggaccCUUUUGACCUg 5' |||:|||||: Ref: 5' uucucaaaugaaGAAGACUGGGa 3' |
123.00 | -16.54 | 2-12 | 1002-1024 | |
Query: 3' ucccUAAGGACCCUUUUGACCUg 5' | | :|| | || ||||| Ref: 5' aaccAGUAUUGAG-AACCUGGAg 3' |
121.00 | -12.16 | 2-20 | 407-428 |
The Predicated Binding Sites between MIR145 and POU5F1P5 | ||||
By RIsearch | Structure | MIR145 Location | POU5F1P5 Location | Score |
Query: 3' CCAGUUUUCCCAGGAAUCCCU 5' |||||| :||||:: ||||: Target: 5' GGUCAACGGGGUUUG-AGGGG 3' |
3-23 | 919-938 | -22.80 |
The Predicated Binding Sites of POU5F1P5 | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.