Detail-Interactions: | |
RAID ID: | RRI00000030 |
---|---|
RNA/Protein Symbol 1: | KRASP1(KRAS1P) |
RNA/Protein Category 1: | lncRNA |
RNA/Protein Symbol 2: | MIRLET7E(let-7e) |
RNA/Protein Category 2: | miRNA |
Validated Method: | Dual Luciferase reporter assay, RT-PCR |
Tissue: | |
PMID: | 20577206 |
Detail description: | Further examples of such conservation include: miR-34 family binding site on CDK4PS (Supplementary Fig. 12); miR-182 binding site on FOXO3B (Supplementary Fig. 13); miR-17 family binding site on E2F3P1 (Supplementary Fig. 14); miR-143 and let-7 family binding sites on KRAS1P (Supplementary Fig. 15). |
The Predicated Binding Sites between MIRLET7E and KRASP1 | |||||
By miRanda | Structure | Match Score | Energy Score | MIRLET7E Location | KRASP1 Location |
Query: 3' uugauauGUUGGAGGA-UGGAGu 5' ||| :|||| ||||| Ref: 5' cuggucuCAAAUUCCUGACCUCa 3' |
127.00 | -20.27 | 2-16 | 3255-3277 | |
Query: 3' uugaUAUGUUGGAGGAUGGAGu 5' ||:||::: :|||:|| Ref: 5' gugcAUGCAGUUGAUUACUUCu 3' |
126.00 | -16.25 | 2-19 | 1029-1050 | |
Query: 3' uugauAUGUUGGAGGAUGGAGu 5' |:: | ||::|||||: Ref: 5' caaacUGUUAGCUUUUACCUUa 3' |
125.00 | -20.14 | 2-18 | 875-896 |
The Predicated Binding Sites between MIRLET7E and KRASP1 | ||||
By RIsearch | Structure | MIRLET7E Location | KRASP1 Location | Score |
Query: 3' UGAGGU-AGGAGGUUGU--AUAGUU 5' |||||| ||||: ||| :||:: Target: 5' ACUCCAGUCCUUAAACUCUGGUCGG 3' |
1-22 | 3253-3277 | -18.18 |
The Predicated Binding Sites of KRASP1 | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.