The Detail Information for This Interaction


  • Detail
  • Binding
  • Network
Detail-Interactions:
RAID ID: RRI00000029
RNA/Protein Symbol 1:KRASP1(KRAS1P)
RNA/Protein Category 1: lncRNA
RNA/Protein Symbol 2: MIRLET7D(let-7d)
RNA/Protein Category 2: miRNA
Validated Method: Dual Luciferase reporter assay, RT-PCR
Tissue:  
PMID: 20577206 
Detail description:

Further examples of such conservation include: miR-34 family binding site on CDK4PS (Supplementary Fig. 12); miR-182 binding site on FOXO3B (Supplementary Fig. 13); miR-17 family binding site on E2F3P1 (Supplementary Fig. 14); miR-143 and let-7 family binding sites on KRAS1P (Supplementary Fig. 15). 

The Predicated Binding Sites between MIRLET7D and KRASP1
By miRanda Structure Match Score Energy Score MIRLET7D Location KRASP1 Location
   Query:    3' uugaUACGUUGGAUGAUGGAGa 5'
                    |||||::: |:|||:|| 
   Ref:      5' gugcAUGCAGUUGAUUACUUCu 3'
138.00 -19.65 2-19 1029-1050
   Query:    3' uugaUACGUUGGAU-GAUGGAga 5'
                    |||:||| || :|||||  
   Ref:      5' cuuaAUGUAACAUAUUUACCUgg 3'
133.00 -14.72 3-19 5041-5063
   Query:    3' uuGAUACGUUGGAU-GAUGGAGa 5'
                  || | ::|:||| ||||:|: 
   Ref:      5' aaCUCUUUGAUCUAGCUACUUUa 3'
131.00 -13.25 2-21 3579-3601
The Predicated Binding Sites between MIRLET7D and KRASP1
By RIsearch Structure MIRLET7D Location KRASP1 Location Score
Query:    3' GAGGUA-GUAGGUU-----GCAU 5'
          :|||:| |:|||:      :||:
Target:   5' UUCCGUCCGUCCGUUCUACUGUG 3'
2-18 2564-2586 -15.40
The Predicated Binding Sites of KRASP1
RBPBD
RsiteDB
BindN
BindN+
RNAbindR
Pprint
Visualization:
Select the center nodes: First Node Second Node Both the Nodes
Select the Level of Neighbour: First Neighbour Second Neighbour

The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node, the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node, the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node. Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.


The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.