The Detail Information for This Interaction


  • Detail
  • Binding
  • Network
Detail-Interactions:
RAID ID: RRI00000022
RNA/Protein Symbol 1:GJA1P1(CONNEXIN 43 pseudogene)
RNA/Protein Category 1: lncRNA
RNA/Protein Symbol 2: MIR1-2(miR-1-2)
RNA/Protein Category 2: miRNA
Validated Method: Dual Luciferase reporter assay, RT-PCR
Tissue:  
PMID: 20577206 
Detail description:

Alignments of gene and pseudogenes sequences show that microRNA-binding sites are well conserved; for example, the miR-145 binding site on OCT4 and its pseudogenes OCT4-pg1, 3, 4 and 5 (Supplementary Fig. 11a); miR-1 family binding sites on CONNEXIN 43 (CX43) and its pseudogene (Supplementary Fig. 11b). 

The Predicated Binding Sites between MIR1-2 and GJA1P1
By miRanda Structure Match Score Energy Score MIR1-2 Location GJA1P1 Location 
   Query:    3' uaUGUAUGAAGAAA-UGUAAGGu 5'
                  ||  |:|| ||| ||||||| 
   Ref:      5' uuACUAAUUUGUUUGACAUUCCa 3'
163.00 -15.70 2-21 3058-3080 
   Query:    3' uauguauGAAGA-AAUGUAAGGu 5'
                       || ||   ||||||| 
   Ref:      5' uaaguccCUGCUAAAACAUUCCa 3'
142.00 -12.12 2-16 1919-1941 
   Query:    3' uauGUA-UGAAGAAAU-GUAAGGu 5'
                   ||| ||||:|| | |||||| 
   Ref:      5' uacCAUCACUUUUUCAUCAUUCCu 3'
138.00 -15.55 2-20 2136-2159
The Predicated Binding Sites between MIR1-2 and GJA1P1
By RIsearch Structure MIR1-2 Location GJA1P1 Location Score 
Query:    3' UGGAAUGUAAAGA-----AGUA--------UGUAU 5'
          |||||||| ||:      ||||        ||||:
Target:   5' ACCUUACAGUUUGUUUAAUCAUUAAAAGUAACAUG 3'
1-22 3046-3080 -11.65
The Predicated Binding Sites of GJA1P1
RBPBD 

					

					

						RsiteDB
						
					

						BindN
						
							 

								
					

					

						BindN+
						
							 

								
					

					

					    RNAbindR
						
                              
	 
								
					

					

					    Pprint
						
                            

								
					



				 
	
            			
	

	
    
	
	  
	 

      

	  
Visualization:
	  
	  

	  Select the center nodes:
	   First Node
	   Second Node
	  Both the Nodes	
 
      
Select the Level of Neighbour:
	   First Neighbour
	   Second Neighbour  
	  

	        
	  

	 
	 
	


 
	 

	  The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
	  the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes. 
	  
The 'First Neighbour' represents the sub-network of direct interacting with the center node, 
	  the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node. 
	  Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
	 


	  

	   
	
	

  





	

		

           			
				
	
                   The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
 
				   The Binding page: representing the predicted binding sites and/or constants.
 
				   The Network page: representing the interaction sub-network of interacting RNA/Protein.