Detail-Interactions: | |
RAID ID: | RRI00000021 |
---|---|
RNA/Protein Symbol 1: | GJA1P1(CONNEXIN 43 pseudogene) |
RNA/Protein Category 1: | lncRNA |
RNA/Protein Symbol 2: | MIR1-1(miR-1-1) |
RNA/Protein Category 2: | miRNA |
Validated Method: | Dual Luciferase reporter assay, RT-PCR |
Tissue: | |
PMID: | 20577206 |
Detail description: | Alignments of gene and pseudogenes sequences show that microRNA-binding sites are well conserved; for example, the miR-145 binding site on OCT4 and its pseudogenes OCT4-pg1, 3, 4 and 5 (Supplementary Fig. 11a); miR-1 family binding sites on CONNEXIN 43 (CX43) and its pseudogene (Supplementary Fig. 11b). |
The Predicated Binding Sites between MIR1-1 and GJA1P1 | |||||
By miRanda | Structure | Match Score | Energy Score | MIR1-1 Location | GJA1P1 Location |
Query: 3' uaUGUAUGAAGAAA-UGUAAGGu 5' || |:|| ||| ||||||| Ref: 5' uuACUAAUUUGUUUGACAUUCCa 3' |
163.00 | -15.70 | 2-21 | 3058-3080 | |
Query: 3' uauguauGAAGA-AAUGUAAGGu 5' || || ||||||| Ref: 5' uaaguccCUGCUAAAACAUUCCa 3' |
142.00 | -12.12 | 2-16 | 1919-1941 | |
Query: 3' uauGUA-UGAAGAAAU-GUAAGGu 5' ||| ||||:|| | |||||| Ref: 5' uacCAUCACUUUUUCAUCAUUCCu 3' |
138.00 | -15.55 | 2-20 | 2136-2159 |
The Predicated Binding Sites between MIR1-1 and GJA1P1 | ||||
By RIsearch | Structure | MIR1-1 Location | GJA1P1 Location | Score |
Query: 3' UGGAAUGUAAAGA-----AGUA--------UGUAU 5' |||||||| ||: |||| ||||: Target: 5' ACCUUACAGUUUGUUUAAUCAUUAAAAGUAACAUG 3' |
1-22 | 3046-3080 | -11.65 |
The Predicated Binding Sites of GJA1P1 | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.