The Detail Information for This Interaction


  • Detail
  • Binding
  • Network
Detail-Interactions:
RAID ID: RRI00000021
RNA/Protein Symbol 1:GJA1P1(CONNEXIN 43 pseudogene)
RNA/Protein Category 1: lncRNA
RNA/Protein Symbol 2: MIR1-1(miR-1-1)
RNA/Protein Category 2: miRNA
Validated Method: Dual Luciferase reporter assay, RT-PCR
Tissue:  
PMID: 20577206 
Detail description:

Alignments of gene and pseudogenes sequences show that microRNA-binding sites are well conserved; for example, the miR-145 binding site on OCT4 and its pseudogenes OCT4-pg1, 3, 4 and 5 (Supplementary Fig. 11a); miR-1 family binding sites on CONNEXIN 43 (CX43) and its pseudogene (Supplementary Fig. 11b). 

The Predicated Binding Sites between MIR1-1 and GJA1P1
By miRanda Structure Match Score Energy Score MIR1-1 Location GJA1P1 Location
   Query:    3' uaUGUAUGAAGAAA-UGUAAGGu 5'
                  ||  |:|| ||| ||||||| 
   Ref:      5' uuACUAAUUUGUUUGACAUUCCa 3'
163.00 -15.70 2-21 3058-3080
   Query:    3' uauguauGAAGA-AAUGUAAGGu 5'
                       || ||   ||||||| 
   Ref:      5' uaaguccCUGCUAAAACAUUCCa 3'
142.00 -12.12 2-16 1919-1941
   Query:    3' uauGUA-UGAAGAAAU-GUAAGGu 5'
                   ||| ||||:|| | |||||| 
   Ref:      5' uacCAUCACUUUUUCAUCAUUCCu 3'
138.00 -15.55 2-20 2136-2159
The Predicated Binding Sites between MIR1-1 and GJA1P1
By RIsearch Structure MIR1-1 Location GJA1P1 Location Score
Query:    3' UGGAAUGUAAAGA-----AGUA--------UGUAU 5'
          |||||||| ||:      ||||        ||||:
Target:   5' ACCUUACAGUUUGUUUAAUCAUUAAAAGUAACAUG 3'
1-22 3046-3080 -11.65
The Predicated Binding Sites of GJA1P1
RBPBD
RsiteDB
BindN
BindN+
RNAbindR
Pprint
Visualization:
Select the center nodes: First Node Second Node Both the Nodes
Select the Level of Neighbour: First Neighbour Second Neighbour

The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node, the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node, the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node. Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.


The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.