Detail-Interactions: | |
RAID ID: | RRI00000017 |
---|---|
RNA/Protein Symbol 1: | E2F3P1 |
RNA/Protein Category 1: | lncRNA |
RNA/Protein Symbol 2: | MIR17(miR-17) |
RNA/Protein Category 2: | miRNA |
Validated Method: | Dual Luciferase reporter assay, RT-PCR |
Tissue: | |
PMID: | 20577206 |
Detail description: | Further examples of such conservation include: miR-34 family binding site on CDK4PS (Supplementary Fig. 12); miR-182 binding site on FOXO3B (Supplementary Fig. 13); miR-17 family binding site on E2F3P1 (Supplementary Fig. 14); miR-143 and let-7 family binding sites on KRAS1P (Supplementary Fig. 15). |
The Predicated Binding Sites between MIR17 and E2F3P1 | |||||
By miRanda | Structure | Match Score | Energy Score | MIR17 Location | E2F3P1 Location |
Query: 3' gauggacgugacauUCGUGAAAc 5' |||||||| Ref: 5' agacaggugacaccAGCACUUUa 3' |
145.00 | -12.77 | 2-10 | 3128-3150 | |
Query: 3' gaUGGACGUGACAUUCGUGAAAc 5' |::| ||:| | |||| ||| Ref: 5' acAUUUUCAUUUUUAGCAGUUUu 3' |
137.00 | -10.20 | 2-22 | 3851-3873 | |
Query: 3' gaUGGACGUGACAUU--CGUGAAAc 5' :||| |||| || ||||| | Ref: 5' guGCCU--ACUGGAAAUGCACUGUg 3' |
125.00 | -18.98 | 2-22 | 3341-3363 |
The Predicated Binding Sites between MIR17 and E2F3P1 | ||||
By RIsearch | Structure | MIR17 Location | E2F3P1 Location | Score |
Query: 3' AAAGUGCUUACAGUGCA-----GGUAG 5' |||: |::|||||||| :|||| Target: 5' UUUUUGGGGUGUCACGUAAAGGUCAUC 3' |
2-23 | 3345-3371 | -19.84 |
The Predicated Binding Sites of E2F3P1 | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.