Detail-Interactions: | |
RAID ID: | RRI00000015 |
---|---|
RNA/Protein Symbol 1: | CDK4PS |
RNA/Protein Category 1: | lncRNA |
RNA/Protein Symbol 2: | MIR34C(miR-34c) |
RNA/Protein Category 2: | miRNA |
Validated Method: | Dual Luciferase reporter assay, RT-PCR |
Tissue: | |
PMID: | 20577206 |
Detail description: | Further examples of such conservation include: miR-34 family binding site on CDK4PS (Supplementary Fig. 12); miR-182 binding site on FOXO3B (Supplementary Fig. 13); miR-17 family binding site on E2F3P1 (Supplementary Fig. 14); miR-143 and let-7 family binding sites on KRAS1P (Supplementary Fig. 15). |
The Predicated Binding Sites between MIR34C and CDK4PS | |||||
By miRanda | Structure | Match Score | Energy Score | MIR34C Location | CDK4PS Location |
Query: 3' cguUAGUCGAUUGAUGUGACGGa 5' ||:|| || | |||| || Ref: 5' cccAUUAG--AAAU-CACUCCCa 3' |
119.00 | -9.34 | 2-21 | 275-294 | |
Query: 3' cguuAGUCGAUUGAUGUGACGGa 5' | | ||:|:|: :||||| Ref: 5' ucuuUAACCUGAUUGGGCUGCCu 3' |
119.00 | -20.42 | 2-20 | 722-744 | |
Query: 3' cguuagucgaUUGAUGUGACGGa 5' |::| |||| || Ref: 5' cucucaaaagAGUUCCACUCCCa 3' |
117.00 | -8.87 | 2-14 | 221-243 |
The Predicated Binding Sites between MIR34C and CDK4PS | ||||
By RIsearch | Structure | MIR34C Location | CDK4PS Location | Score |
Query: 3' AGGCAGUGUAGUUAGC----UGAU--UGC 5' ||||||: :|:|:|| ||| ||| Target: 5' UCCGUCGGGUUAGUCCAAUUUCUAAAACG 3' |
1-23 | 716-744 | -20.03 |
The Predicated Binding Sites of CDK4PS | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.