The Detail Information for This Interaction


  • Detail
  • Binding
  • Network
Detail-Interactions:
RAID ID: RRI00000014
RNA/Protein Symbol 1:CDK4PS
RNA/Protein Category 1: lncRNA
RNA/Protein Symbol 2: MIR34B(miR-34b)
RNA/Protein Category 2: miRNA
Validated Method: Dual Luciferase reporter assay, RT-PCR
Tissue:  
PMID: 20577206 
Detail description:

Further examples of such conservation include: miR-34 family binding site on CDK4PS (Supplementary Fig. 12); miR-182 binding site on FOXO3B (Supplementary Fig. 13); miR-17 family binding site on E2F3P1 (Supplementary Fig. 14); miR-143 and let-7 family binding sites on KRAS1P (Supplementary Fig. 15). 

The Predicated Binding Sites between MIR34B and CDK4PS
By miRanda Structure Match Score Energy Score MIR34B Location CDK4PS Location 
   Query:    3' guuAGUCGAUUACUGUGACGGAu 5'
                   | | ||:|| : :|||||| 
   Ref:      5' cuuUAACCUGAUUGGGCUGCCUc 3'
144.00 -15.48 2-21 723-745 
   Query:    3' guuaguCGAU-UACUGUGACGGAu 5'
                      |||: | || |||| || 
   Ref:      5' uaugguGCUGCAAGA-ACUGGCUc 3'
118.00 -11.86 2-18 14-36 
   Query:    3' guuagucgaUUA-CUGUGACGGau 5'
                         ||| || :|||||  
   Ref:      5' cacagaaggAAUAGAAGCUGCCau 3'
117.00 -15.07 3-15 952-975
The Predicated Binding Sites between MIR34B and CDK4PS
By RIsearch Structure MIR34B Location CDK4PS Location Score 
Query:    3' UAGGCAGUGUCAUUAGCUGAUUG 5'
          :|||||         :|:||:||
Target:   5' GUCCGUG-------GUGGCUGAC 3'
1-23 817-832 -15.73
The Predicated Binding Sites of CDK4PS
RBPBD 

					

					

						RsiteDB
						
					

						BindN
						
							 

								
					

					

						BindN+
						
							 

								
					

					

					    RNAbindR
						
                              
	 
								
					

					

					    Pprint
						
                            

								
					



				 
	
            			
	

	
    
	
	  
	 

      

	  
Visualization:
	  
	  

	  Select the center nodes:
	   First Node
	   Second Node
	  Both the Nodes	
 
      
Select the Level of Neighbour:
	   First Neighbour
	   Second Neighbour  
	  

	        
	  

	 
	 
	


 
	 

	  The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
	  the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes. 
	  
The 'First Neighbour' represents the sub-network of direct interacting with the center node, 
	  the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node. 
	  Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
	 


	  

	   
	
	

  





	

		

           			
				
	
                   The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
 
				   The Binding page: representing the predicted binding sites and/or constants.
 
				   The Network page: representing the interaction sub-network of interacting RNA/Protein.