ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-424

MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0004749 hsa-miR-424-3p	CAAAACGUGAGGCGCUGCUAU	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0004749 hsa-miR-424-3p	CAAAACGUGAGGCGCUGCUAU	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0000590	MIPF0000164	CCUCGUUGACUCCGAAGGGCUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGGAA	MIMAT0000549 mmu-miR-322-3p	AAACAUGAAGCGCUGCAACAC	The mir-322 locus appears able to express two mature miRNA sequences. Poyet al. cloned a sequence originating from the 5' arm from mouse pancreaticbeta cells . This sequence is orthologous to the experimentallyvalidated miR-424 sequence from human (MIR:MI0001446), but was namedmiR-322-5p in . The mature product from the 3' arm of this precursorsequence is the predicted mouse homologue of miR-322, experimentallyverified in rat (MIR:MI0000589) , and later in mouse . Theorthologous human locus does not appear to contain the miR-322 sequence.Landgraf et al. confirm that the 5' product is the predominant one .The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0004749 hsa-miR-424-3p	CAAAACGUGAGGCGCUGCUAU	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0004749 hsa-miR-424-3p	CAAAACGUGAGGCGCUGCUAU	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0004749 hsa-miR-424-3p	CAAAACGUGAGGCGCUGCUAU	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0004749 hsa-miR-424-3p	CAAAACGUGAGGCGCUGCUAU	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0004749 hsa-miR-424-3p	CAAAACGUGAGGCGCUGCUAU	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0004749 hsa-miR-424-3p	CAAAACGUGAGGCGCUGCUAU	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0004749 hsa-miR-424-3p	CAAAACGUGAGGCGCUGCUAU	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.
MI0001446	MIPF0000164	CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG	MIMAT0001341 hsa-miR-424-5p	CAGCAGCAAUUCAUGUUUUGAA	This hairpin precursor expresses a 5' arm product, named miR-424, in humanpromyelocytic leukemia (HL-60) cells . The level of expression ofmiR-424 was shown to be up-regulated 48 hours after TPA-induction. Thesequence is orthologous to the experimentally verified rat miR-322 locus(MIR:MI0000589), which expresses its mature product from the 3' arm of thehairpin. The human miR-424 hairpin does not appear to contain the miR-322sequence.

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

TRAP1,SPI1,PLAG1,HUWE1,APBB2,ARID2,PNISR,ATF6,IARS,HIST2H2AA3,ITPR1,CCND1,CCIN,ANLN,EIF4G2
more » TRAP1,SPI1,PLAG1,HUWE1,APBB2,ARID2,PNISR,ATF6,IARS,HIST2H2AA3,ITPR1,CCND1,CCIN,ANLN,EIF4G2,TBPL1,MAP2K1,YWHAQ,PIAS1,CCNF,ANKRD17,KIF23,CCND3,RBM4B,CNIH4,SMURF1,CUL2,CDC14A,CCNE1,NFIA,MYB,HIST1H2BK,LGALS3,C7orf59,SCOC,HIF1A,SMARCA5,IFIH1,SIAH1,WEE1,CDK6,CDC25A,TMF1,GTF2A1,FGFR1,BAZ2B,CHEK1,TTC39A,SACS,ANKHD1

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa04110	Cell cycle	CCND1,YWHAQ,CDK6,CDC14A,CDC25A,CHEK1,WEE1,CCNE1,CCND3,	1.59E-7
hsa04115	p53 signaling pathway	CCND1,CDK6,CHEK1,SIAH1,CCNE1,CCND3,	2.36E-5
hsa05200	Pathways in cancer	CCND1,PIAS1,CDK6,CUL2,MAP2K1,HIF1A,SPI1,CCNE1,FGFR1,	2.06E-4
hsa04120	Ubiquitin mediated proteolysis	HUWE1,PIAS1,SMURF1,CUL2,SIAH1,	5.46E-2
hsa05218	Melanoma	CCND1,CDK6,MAP2K1,FGFR1,	6.00E-2

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0007049	cell cycle	CCND1,CDC14A,MAP2K1,CHEK1,APBB2,WEE1,ANLN,EIF4G2,CDK6,CCNF,CDC25A,CUL2,KIF23,CCNE1,SIAH1,CCND3,	2.01E-8
GO:0022402	cell cycle process	CCND1,MAP2K1,APBB2,CHEK1,WEE1,ANLN,EIF4G2,CCNF,CDK6,CDC25A,CUL2,KIF23,CCNE1,	2.65E-7
GO:0000278	mitotic cell cycle	CCND1,CDK6,CCNF,CUL2,CDC25A,KIF23,MAP2K1,CHEK1,WEE1,CCNE1,ANLN,	3.51E-7
GO:0051301	cell division	CCND1,CDK6,CCNF,CDC14A,CDC25A,KIF23,WEE1,CCNE1,ANLN,CCND3,	5.35E-7
GO:0022403	cell cycle phase	CCND1,CDK6,CCNF,CUL2,CDC25A,KIF23,MAP2K1,CHEK1,WEE1,CCNE1,ANLN,	9.82E-7

GO:0051329	interphase of mitotic cell cycle	CCND1,CDK6,CUL2,CDC25A,CHEK1,CCNE1,	2.48E-5
GO:0051325	interphase	CCND1,CDK6,CUL2,CDC25A,CHEK1,CCNE1,	2.85E-5
GO:0000079	regulation of cyclin-dependent protein kinase activity	CCND1,CDC25A,CHEK1,CCND3,	8.08E-4
GO:0000279	M phase	CCNF,CDC25A,KIF23,MAP2K1,CHEK1,WEE1,ANLN,	8.15E-4
GO:0051726	regulation of cell cycle	CCND1,CDK6,CDC25A,APBB2,CHEK1,ANLN,CCND3,	8.41E-4
GO:0007067	mitosis	CCNF,CDC25A,KIF23,MAP2K1,WEE1,ANLN,	8.65E-4
GO:0000280	nuclear division	CCNF,CDC25A,KIF23,MAP2K1,WEE1,ANLN,	8.65E-4
GO:0000082	G1/S transition of mitotic cell cycle	CCND1,CUL2,CDC25A,CCNE1,	8.99E-4
GO:0000087	M phase of mitotic cell cycle	CCNF,CDC25A,KIF23,MAP2K1,WEE1,ANLN,	9.38E-4
GO:0048285	organelle fission	CCNF,CDC25A,KIF23,MAP2K1,WEE1,ANLN,	1.03E-2
GO:0045646	regulation of erythrocyte differentiation	CDK6,HIF1A,SPI1,	1.67E-2
GO:0045449	regulation of transcription	PIAS1,YWHAQ,TMF1,MAGED1,NFIA,MAP2K1,APBB2,HIF1A,SPI1,SMARCA5,MYB,ATF6,GTF2A1,PLAG1,BAZ2B,CCNE1,ARID2,TBPL1,	3.73E-2
GO:0033197	response to vitamin E	CCND1,CCNE1,	6.78E-2
GO:0010604	positive regulation of macromolecule metabolic process	CCND1,PIAS1,SMURF1,ATF6,MAP2K1,HIF1A,SPI1,CCNE1,CCND3,	7.64E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value