错误信息提示:
错误号:12142

错误原因:Table 'hscellor_ncrdeathdb.ncrnadeathmiRNA2targetDB' doesn't exist

错误sql语句:
select * from ncrnadeathmiRNA2targetDB where mirnaSymbol like '%miR-322' and taxid like '10116'
——错误记录被保存!

ncRNADetailInformation
  • Detail Information
miRNA namepre-miRNA familypre-miRNA Sequencemature-miRNAmature sequencepre-miRNA description
miR-322
MI0031763 CCUCGCUGACUCCGAAGGGAUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGAAA MIMAT0000547

rno-miR-322-3p
AAACAUGAAGCGCUGCAACA Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons .The miR-322 locus has an orthologous sequence in human (MIR:MI0001446),which expresses an experimentally validated mature miRNA sequence from its5' arm, named miR-424. The human mir-424 locus does not appear to containa homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590)appears able to express both miR-322 and miR-424. Both miR-322 andmiR-424 have been experimentally verified in rat. Landgraf et al. showthat the 5' product is the predominant one . The 5' product istherefore renamed miR-322 and the 3' product renamed miR-322*.
MI0031763 CCUCGCUGACUCCGAAGGGAUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGAAA MIMAT0001619

rno-miR-322-5p
CAGCAGCAAUUCAUGUUUUGGA Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons .The miR-322 locus has an orthologous sequence in human (MIR:MI0001446),which expresses an experimentally validated mature miRNA sequence from its5' arm, named miR-424. The human mir-424 locus does not appear to containa homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590)appears able to express both miR-322 and miR-424. Both miR-322 andmiR-424 have been experimentally verified in rat. Landgraf et al. showthat the 5' product is the predominant one . The 5' product istherefore renamed miR-322 and the 3' product renamed miR-322*.
MI0031763 CCUCGCUGACUCCGAAGGGAUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGAAA MIMAT0000547

rno-miR-322-3p
AAACAUGAAGCGCUGCAACA Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons .The miR-322 locus has an orthologous sequence in human (MIR:MI0001446),which expresses an experimentally validated mature miRNA sequence from its5' arm, named miR-424. The human mir-424 locus does not appear to containa homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590)appears able to express both miR-322 and miR-424. Both miR-322 andmiR-424 have been experimentally verified in rat. Landgraf et al. showthat the 5' product is the predominant one . The 5' product istherefore renamed miR-322 and the 3' product renamed miR-322*.
MI0031763 CCUCGCUGACUCCGAAGGGAUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGAAA MIMAT0001619

rno-miR-322-5p
CAGCAGCAAUUCAUGUUUUGGA Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons .The miR-322 locus has an orthologous sequence in human (MIR:MI0001446),which expresses an experimentally validated mature miRNA sequence from its5' arm, named miR-424. The human mir-424 locus does not appear to containa homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590)appears able to express both miR-322 and miR-424. Both miR-322 andmiR-424 have been experimentally verified in rat. Landgraf et al. showthat the 5' product is the predominant one . The 5' product istherefore renamed miR-322 and the 3' product renamed miR-322*.
MI0031763 CCUCGCUGACUCCGAAGGGAUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGAAA MIMAT0001619

rno-miR-322-5p
CAGCAGCAAUUCAUGUUUUGGA Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons .The miR-322 locus has an orthologous sequence in human (MIR:MI0001446),which expresses an experimentally validated mature miRNA sequence from its5' arm, named miR-424. The human mir-424 locus does not appear to containa homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590)appears able to express both miR-322 and miR-424. Both miR-322 andmiR-424 have been experimentally verified in rat. Landgraf et al. showthat the 5' product is the predominant one . The 5' product istherefore renamed miR-322 and the 3' product renamed miR-322*.
MI0031763 CCUCGCUGACUCCGAAGGGAUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGAAA MIMAT0001619

rno-miR-322-5p
CAGCAGCAAUUCAUGUUUUGGA Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons .The miR-322 locus has an orthologous sequence in human (MIR:MI0001446),which expresses an experimentally validated mature miRNA sequence from its5' arm, named miR-424. The human mir-424 locus does not appear to containa homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590)appears able to express both miR-322 and miR-424. Both miR-322 andmiR-424 have been experimentally verified in rat. Landgraf et al. showthat the 5' product is the predominant one . The 5' product istherefore renamed miR-322 and the 3' product renamed miR-322*.
MI0031763 CCUCGCUGACUCCGAAGGGAUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGAAA MIMAT0001619

rno-miR-322-5p
CAGCAGCAAUUCAUGUUUUGGA Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons .The miR-322 locus has an orthologous sequence in human (MIR:MI0001446),which expresses an experimentally validated mature miRNA sequence from its5' arm, named miR-424. The human mir-424 locus does not appear to containa homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590)appears able to express both miR-322 and miR-424. Both miR-322 andmiR-424 have been experimentally verified in rat. Landgraf et al. showthat the 5' product is the predominant one . The 5' product istherefore renamed miR-322 and the 3' product renamed miR-322*.
MI0031763 CCUCGCUGACUCCGAAGGGAUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGAAA MIMAT0001619

rno-miR-322-5p
CAGCAGCAAUUCAUGUUUUGGA Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons .The miR-322 locus has an orthologous sequence in human (MIR:MI0001446),which expresses an experimentally validated mature miRNA sequence from its5' arm, named miR-424. The human mir-424 locus does not appear to containa homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590)appears able to express both miR-322 and miR-424. Both miR-322 andmiR-424 have been experimentally verified in rat. Landgraf et al. showthat the 5' product is the predominant one . The 5' product istherefore renamed miR-322 and the 3' product renamed miR-322*.
link to database TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0
Interacted genes from RAID,miRTarBase

more »
KEGG pathways enriched for interacted genes
pathway namepathway descriptiontarget genes enrich in pathwayp-value
Gene ontology terms enriched for interacted genes
GO termsGO terms descriptiontarget genes enrich in GO termp-value
KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.
disease namerelated genesp-value