错误信息提示:
错误号:12142

错误原因:Table 'hscellor_ncrdeathdb.ncrnadeathmiRNA2targetDB' doesn't exist

错误sql语句:
select * from ncrnadeathmiRNA2targetDB where mirnaSymbol like '%miR-196a' and taxid like '9606'
——错误记录被保存!

ncRNADetailInformation
  • Detail Information
miRNA namepre-miRNA familypre-miRNA Sequencemature-miRNAmature sequencepre-miRNA description
miR-196a
MI0000279 MIPF0000031 UGCUCGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUCGGUUUUCGUCGAGGGC MIMAT0000226

hsa-miR-196a-5p
UAGGUAGUUUCAUGUUGUUGGG This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. miR-196awas later validated in human [3,4]. Yekta et al. report that miR-196miRNAs are expressed from HOX gene clusters in mammals, and that HOX genesin these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown tobe a natural target for miR-196-directed cleavage through a perfectlycomplementary miR-target site. Other HOX genes have imperfect miR-196complementary sites indicative of regulation by translational repression. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000279 MIPF0000031 UGCUCGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUCGGUUUUCGUCGAGGGC MIMAT0004562

hsa-miR-196a-3p
CGGCAACAAGAAACUGCCUGAG This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. miR-196awas later validated in human [3,4]. Yekta et al. report that miR-196miRNAs are expressed from HOX gene clusters in mammals, and that HOX genesin these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown tobe a natural target for miR-196-directed cleavage through a perfectlycomplementary miR-target site. Other HOX genes have imperfect miR-196complementary sites indicative of regulation by translational repression. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000279 MIPF0000031 UGCUCGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUCGGUUUUCGUCGAGGGC MIMAT0000226

hsa-miR-196a-5p
UAGGUAGUUUCAUGUUGUUGGG This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. miR-196awas later validated in human [3,4]. Yekta et al. report that miR-196miRNAs are expressed from HOX gene clusters in mammals, and that HOX genesin these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown tobe a natural target for miR-196-directed cleavage through a perfectlycomplementary miR-target site. Other HOX genes have imperfect miR-196complementary sites indicative of regulation by translational repression. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000279 MIPF0000031 UGCUCGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUCGGUUUUCGUCGAGGGC MIMAT0004562

hsa-miR-196a-3p
CGGCAACAAGAAACUGCCUGAG This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. miR-196awas later validated in human [3,4]. Yekta et al. report that miR-196miRNAs are expressed from HOX gene clusters in mammals, and that HOX genesin these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown tobe a natural target for miR-196-directed cleavage through a perfectlycomplementary miR-target site. Other HOX genes have imperfect miR-196complementary sites indicative of regulation by translational repression. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000279 MIPF0000031 UGCUCGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUCGGUUUUCGUCGAGGGC MIMAT0000226

hsa-miR-196a-5p
UAGGUAGUUUCAUGUUGUUGGG This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. miR-196awas later validated in human [3,4]. Yekta et al. report that miR-196miRNAs are expressed from HOX gene clusters in mammals, and that HOX genesin these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown tobe a natural target for miR-196-directed cleavage through a perfectlycomplementary miR-target site. Other HOX genes have imperfect miR-196complementary sites indicative of regulation by translational repression. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000279 MIPF0000031 UGCUCGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUCGGUUUUCGUCGAGGGC MIMAT0004562

hsa-miR-196a-3p
CGGCAACAAGAAACUGCCUGAG This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. miR-196awas later validated in human [3,4]. Yekta et al. report that miR-196miRNAs are expressed from HOX gene clusters in mammals, and that HOX genesin these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown tobe a natural target for miR-196-directed cleavage through a perfectlycomplementary miR-target site. Other HOX genes have imperfect miR-196complementary sites indicative of regulation by translational repression. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
link to database TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0
Interacted genes from RAID,miRTarBase

more »
KEGG pathways enriched for interacted genes
pathway namepathway descriptiontarget genes enrich in pathwayp-value
Gene ontology terms enriched for interacted genes
GO termsGO terms descriptiontarget genes enrich in GO termp-value
KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.
disease namerelated genesp-value