ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-185

MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0000455 hsa-miR-185-5p	UGGAGAGAAAGGCAGUUCCUGA	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0004611 hsa-miR-185-3p	AGGGGCUGGCUUUCCUCUGGUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0000455 hsa-miR-185-5p	UGGAGAGAAAGGCAGUUCCUGA	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0004611 hsa-miR-185-3p	AGGGGCUGGCUUUCCUCUGGUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0000455 hsa-miR-185-5p	UGGAGAGAAAGGCAGUUCCUGA	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0004611 hsa-miR-185-3p	AGGGGCUGGCUUUCCUCUGGUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0000455 hsa-miR-185-5p	UGGAGAGAAAGGCAGUUCCUGA	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0004611 hsa-miR-185-3p	AGGGGCUGGCUUUCCUCUGGUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0000455 hsa-miR-185-5p	UGGAGAGAAAGGCAGUUCCUGA	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0004611 hsa-miR-185-3p	AGGGGCUGGCUUUCCUCUGGUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0000455 hsa-miR-185-5p	UGGAGAGAAAGGCAGUUCCUGA	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0004611 hsa-miR-185-3p	AGGGGCUGGCUUUCCUCUGGUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0000455 hsa-miR-185-5p	UGGAGAGAAAGGCAGUUCCUGA	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0004611 hsa-miR-185-3p	AGGGGCUGGCUUUCCUCUGGUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0000455 hsa-miR-185-5p	UGGAGAGAAAGGCAGUUCCUGA	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .
MI0000482	MIPF0000202	AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA	MIMAT0004611 hsa-miR-185-3p	AGGGGCUGGCUUUCCUCUGGUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse . Its expression was later verified in human BC-1 cells. The mature sequence shown here represents the most commonly clonedform from large-scale cloning studies .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

ATP5G2,MPV17,RAPH1,EIF4H,CACHD1,MED17,ARL9,TUBB,DENND2A,HMGA2,GCN1L1,EPAS1,NFE2L1,ATR,KIAA0368
more » ATP5G2,MPV17,RAPH1,EIF4H,CACHD1,MED17,ARL9,TUBB,DENND2A,HMGA2,GCN1L1,EPAS1,NFE2L1,ATR,KIAA0368,NTRK3,AKT1,RHOA,C16orf70,CNOT3,DNAJC8,CDC42,SMG7,SCD,CANX,NACC1,RAE1,UBA52,MATR3,AR,LDHB,WNT5B,CORO2B,WDR77,FRMPD4,KITLG,MLF1IP,TMEM160,AHCYL2,GPR108,ACTN4,SCARB1,EIF2C1,MARS,DIAPH1,IBTK,CCNE1,SMG6,GLB1L3,COPB1,PSMB6,MSL3,GLUL,FASTK,C4orf44,PPP1CC,XPO6,LUZP1,TRRAP,SREBF1,GOLGA2P5,APEX1,CTTN,STK35,SIX1,EEF2,UBR4,GLUD1,CDK6,C19orf63,CYFIP1,GSTA4,AP3M1,AKT1S1,PDPK1,DAZAP1,CAMKK2,HSP90AA1,SET,DNMT1,WBSCR16,RAB1B,ANKHD1,PBX2,EEF1A1,ARL16,AADACL3,ASH1L,PLEKHB2,PHACTR2,LENG8

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05200	Pathways in cancer	WNT5B,CDK6,KITLG,RHOA,HSP90AA1,AR,EPAS1,CCNE1,AKT1,CDC42,	3.44E-4
hsa04530	Tight junction	CTTN,RHOA,ASH1L,ACTN4,AKT1,CDC42,	2.30E-2
hsa04510	Focal adhesion	DIAPH1,RHOA,PPP1CC,PDPK1,ACTN4,AKT1,CDC42,	2.55E-2
hsa05215	Prostate cancer	HSP90AA1,AR,PDPK1,CCNE1,AKT1,	3.36E-2
hsa05130	Pathogenic Escherichia coli infection	CTTN,RHOA,TUBB,CDC42,	7.33E-2

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0032268	regulation of cellular protein metabolic process	GCN1L1,ANKHD1,KITLG,EIF4H,SET,EIF2C1,IBTK,DNMT1,PSMB6,AKT1,UBA52,	2.17E-4
GO:0032269	negative regulation of cellular protein metabolic process	ANKHD1,SET,EIF2C1,IBTK,DNMT1,PSMB6,UBA52,	4.15E-4
GO:0051130	positive regulation of cellular component organization	RHOA,PDPK1,ACTN4,DNMT1,AKT1,CDC42,NTRK3,	4.27E-4
GO:0051248	negative regulation of protein metabolic process	ANKHD1,SET,EIF2C1,IBTK,DNMT1,PSMB6,UBA52,	5.08E-4
GO:0051173	positive regulation of nitrogen compound metabolic process	PBX2,KITLG,HSP90AA1,AR,EPAS1,SREBF1,CAMKK2,MED17,CCNE1,SIX1,AKT1,UBA52,	6.29E-4

GO:0031328	positive regulation of cellular biosynthetic process	PBX2,KITLG,HSP90AA1,AR,EPAS1,SREBF1,CAMKK2,MED17,CCNE1,SIX1,AKT1,UBA52,	1.04E-2
GO:0009891	positive regulation of biosynthetic process	PBX2,KITLG,HSP90AA1,AR,EPAS1,SREBF1,CAMKK2,MED17,CCNE1,SIX1,AKT1,UBA52,	1.17E-2
GO:0006913	nucleocytoplasmic transport	XPO6,SMG6,SET,SMG7,AKT1,RAE1,	1.52E-2
GO:0051169	nuclear transport	XPO6,SMG6,SET,SMG7,AKT1,RAE1,	1.61E-2
GO:0010604	positive regulation of macromolecule metabolic process	PBX2,EPAS1,DNMT1,MED17,AKT1,PSMB6,UBA52,KITLG,AR,SREBF1,CAMKK2,SIX1,CCNE1,	1.98E-2
GO:0010557	positive regulation of macromolecule biosynthetic process	PBX2,KITLG,AR,EPAS1,SREBF1,CAMKK2,MED17,CCNE1,SIX1,AKT1,UBA52,	2.57E-2
GO:0031400	negative regulation of protein modification process	SET,IBTK,DNMT1,PSMB6,UBA52,	3.88E-2
GO:0010628	positive regulation of gene expression	PBX2,AR,EPAS1,SREBF1,CAMKK2,MED17,DNMT1,CCNE1,SIX1,UBA52,	3.90E-2
GO:0051168	nuclear export	XPO6,SMG6,SMG7,RAE1,	4.13E-2
GO:0019220	regulation of phosphate metabolic process	SMG6,KITLG,AKT1S1,IBTK,PDPK1,CAMKK2,SMG7,AKT1,CDC42,	4.48E-2
GO:0051174	regulation of phosphorus metabolic process	SMG6,KITLG,AKT1S1,IBTK,PDPK1,CAMKK2,SMG7,AKT1,CDC42,	4.48E-2
GO:0006351	transcription, DNA-dependent	MSL3,NFE2L1,APEX1,ASH1L,AR,EPAS1,MED17,	4.87E-2
GO:0032774	RNA biosynthetic process	MSL3,NFE2L1,APEX1,ASH1L,AR,EPAS1,MED17,	5.20E-2
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	PBX2,KITLG,AR,EPAS1,SREBF1,CAMKK2,MED17,CCNE1,SIX1,UBA52,	6.20E-2
GO:0006417	regulation of translation	GCN1L1,ANKHD1,EIF4H,EIF2C1,AKT1,	6.38E-2
GO:0030036	actin cytoskeleton organization	CORO2B,DIAPH1,RHOA,PDPK1,ACTN4,CDC42,	7.44E-2
GO:0006366	transcription from RNA polymerase II promoter	MSL3,NFE2L1,APEX1,ASH1L,EPAS1,MED17,	8.58E-2
GO:0046907	intracellular transport	XPO6,SMG6,C16orf70,HSP90AA1,SET,COPB1,SMG7,AKT1,RAE1,AP3M1,	8.58E-2
GO:0030029	actin filament-based process	CORO2B,DIAPH1,RHOA,PDPK1,ACTN4,CDC42,	9.67E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value