ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-181b

MI0000683	MIPF0000007	CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA	MIMAT0000257 hsa-miR-181b-5p	AACAUUCAUUGCUGUCGGUGGGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells . There are twopredicted hairpin precursor sequences in the human genome; mir-181b-1(MIR:MI0000270) is found on chromosome 1 , and mir-181b-2(MIR:MI0000683) on chromosome 9 . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
	MIPF0001858		MIMAT00226921
MI0000683	MIPF0000007	CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA	MIMAT0000257 hsa-miR-181b-5p	AACAUUCAUUGCUGUCGGUGGGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells . There are twopredicted hairpin precursor sequences in the human genome; mir-181b-1(MIR:MI0000270) is found on chromosome 1 , and mir-181b-2(MIR:MI0000683) on chromosome 9 . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
	MIPF0001858		MIMAT00226921
MI0000683	MIPF0000007	CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA	MIMAT0000257 hsa-miR-181b-5p	AACAUUCAUUGCUGUCGGUGGGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells . There are twopredicted hairpin precursor sequences in the human genome; mir-181b-1(MIR:MI0000270) is found on chromosome 1 , and mir-181b-2(MIR:MI0000683) on chromosome 9 . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
	MIPF0001858		MIMAT00226921
MI0000683	MIPF0000007	CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA	MIMAT0000257 hsa-miR-181b-5p	AACAUUCAUUGCUGUCGGUGGGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells . There are twopredicted hairpin precursor sequences in the human genome; mir-181b-1(MIR:MI0000270) is found on chromosome 1 , and mir-181b-2(MIR:MI0000683) on chromosome 9 . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
	MIPF0001858		MIMAT00226921
MI0000683	MIPF0000007	CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA	MIMAT0000257 hsa-miR-181b-5p	AACAUUCAUUGCUGUCGGUGGGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells . There are twopredicted hairpin precursor sequences in the human genome; mir-181b-1(MIR:MI0000270) is found on chromosome 1 , and mir-181b-2(MIR:MI0000683) on chromosome 9 . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
	MIPF0001858		MIMAT00226921
MI0000683	MIPF0000007	CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA	MIMAT0000257 hsa-miR-181b-5p	AACAUUCAUUGCUGUCGGUGGGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells . There are twopredicted hairpin precursor sequences in the human genome; mir-181b-1(MIR:MI0000270) is found on chromosome 1 , and mir-181b-2(MIR:MI0000683) on chromosome 9 . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000683	MIPF0000007	CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA	MIMAT0000257 hsa-miR-181b-5p	AACAUUCAUUGCUGUCGGUGGGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells . There are twopredicted hairpin precursor sequences in the human genome; mir-181b-1(MIR:MI0000270) is found on chromosome 1 , and mir-181b-2(MIR:MI0000683) on chromosome 9 . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000683	MIPF0000007	CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA	MIMAT0000257 hsa-miR-181b-5p	AACAUUCAUUGCUGUCGGUGGGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells . There are twopredicted hairpin precursor sequences in the human genome; mir-181b-1(MIR:MI0000270) is found on chromosome 1 , and mir-181b-2(MIR:MI0000683) on chromosome 9 . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000683	MIPF0000007	CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA	MIMAT0000257 hsa-miR-181b-5p	AACAUUCAUUGCUGUCGGUGGGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells . There are twopredicted hairpin precursor sequences in the human genome; mir-181b-1(MIR:MI0000270) is found on chromosome 1 , and mir-181b-2(MIR:MI0000683) on chromosome 9 . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000683	MIPF0000007	CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA	MIMAT0000257 hsa-miR-181b-5p	AACAUUCAUUGCUGUCGGUGGGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells . There are twopredicted hairpin precursor sequences in the human genome; mir-181b-1(MIR:MI0000270) is found on chromosome 1 , and mir-181b-2(MIR:MI0000683) on chromosome 9 . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

TMED7,XIAP,ZFHX3,SRRM2,MCL1,DIDO1,ZBTB20,MED14,KAT2B,HIST1H1E,MYO1C,C14orf126,EIF4E2,USP10,NDE1
more » TMED7,XIAP,ZFHX3,SRRM2,MCL1,DIDO1,ZBTB20,MED14,KAT2B,HIST1H1E,MYO1C,C14orf126,EIF4E2,USP10,NDE1,EP300,RNF187,FGFR1,RPS7,FUS,INO80B,PLAG1,KRI1,HUWE1,UBB,DDHD1,NRD1,KIAA1524,ATP6,USP24,LMCD1,DNAJB11,NLK,IFNGR1,ZXDC,KPNA2,IGF1R,ILF2,NR2F1,CYLD,GANAB,SIRT1,MRPS23,SCAP,RPS8,GRIA2,KPNB1,KLHL7,RPRD1A,ZNF747,E2F1,XPO6,CDX2,TAF5L,VSNL1,C17orf100,TRRAP,C20orf43,EIF5A,RAP1GAP2,CAT,RBMX,NEK3,NRBP1,ZBTB4,TMEM48,BPTF,MEPCE,ASB13,XRCC6,TCL1A,CBX7,THOC3,FAM5B,PTEN,C2orf69,TIMP3,EIF3C,ZNF526,MAP3K10,GATA6,BCL2,ZNF503,HIST2H4B,C5orf34,MTOR,C20orf173,TMEM189,RPL18A,PDHX,ARHGAP35,SEC24C,FBL,PWP2,RQCD1,OSBPL8

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05215	Prostate cancer	IGF1R,PTEN,E2F1,BCL2,EP300,FGFR1,MTOR,	1.02E-5
hsa05200	Pathways in cancer	IGF1R,PTEN,E2F1,BCL2,EP300,XIAP,FGFR1,MTOR,	2.43E-2
hsa05214	Glioma	IGF1R,PTEN,E2F1,MTOR,	5.79E-2
hsa05218	Melanoma	IGF1R,PTEN,E2F1,FGFR1,	8.08E-2
hsa04520	Adherens junction	IGF1R,NLK,EP300,FGFR1,	1.01E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0010557	positive regulation of macromolecule biosynthetic process	E2F1,ILF2,EP300,GATA6,CDX2,MED14,UBB,SCAP,MTOR,IGF1R,EIF5A,ZXDC,XRCC6,BPTF,	1.25E-4
GO:0018205	peptidyl-lysine modification	KAT2B,EIF5A,EP300,SIRT1,	1.32E-4
GO:0045449	regulation of transcription	E2F1,NR2F1,ILF2,EP300,TMEM189,GATA6,ZNF747,MED14,CDX2,ZBTB4,CAT,SCAP,RQCD1,ZXDC,LMCD1,PLAG1,NLK,KAT2B,MAP3K10,TAF5L,UBB,CBX7,ZFHX3,ZNF526,ZBTB20,ZNF503,ARHGAP35,XRCC6,BPTF,TRRAP,SIRT1,	1.32E-4
GO:0010604	positive regulation of macromolecule metabolic process	E2F1,BCL2,ILF2,EP300,GATA6,CDX2,MED14,UBB,NRD1,SCAP,MTOR,IGF1R,EIF5A,ZXDC,XRCC6,BPTF,	1.49E-4
GO:0031328	positive regulation of cellular biosynthetic process	E2F1,ILF2,EP300,GATA6,CDX2,MED14,UBB,SCAP,MTOR,IGF1R,EIF5A,ZXDC,XRCC6,BPTF,	1.99E-4

GO:0009891	positive regulation of biosynthetic process	E2F1,ILF2,EP300,GATA6,CDX2,MED14,UBB,SCAP,MTOR,IGF1R,EIF5A,ZXDC,XRCC6,BPTF,	2.29E-4
GO:0006325	chromatin organization	HUWE1,KAT2B,EP300,TAF5L,BPTF,TRRAP,HIST2H4B,SIRT1,CBX7,HIST1H1E,	4.17E-4
GO:0051276	chromosome organization	HUWE1,KAT2B,EP300,TAF5L,XRCC6,BPTF,TRRAP,HIST2H4B,SIRT1,CBX7,HIST1H1E,	6.12E-4
GO:0006412	translation	RPS8,EIF4E2,RPS7,RPL18A,EIF5A,EIF3C,CYLD,RPS12,UBB,	8.03E-4
GO:0016570	histone modification	HUWE1,KAT2B,EP300,TAF5L,TRRAP,SIRT1,	8.14E-4
GO:0016569	covalent chromatin modification	HUWE1,KAT2B,EP300,TAF5L,TRRAP,SIRT1,	9.42E-4
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	IGF1R,E2F1,ILF2,EP300,ZXDC,XRCC6,GATA6,CDX2,BPTF,MED14,UBB,SCAP,	1.18E-2
GO:0016568	chromatin modification	HUWE1,KAT2B,EP300,TAF5L,BPTF,TRRAP,SIRT1,CBX7,	1.25E-2
GO:0051173	positive regulation of nitrogen compound metabolic process	IGF1R,E2F1,ILF2,EP300,ZXDC,XRCC6,GATA6,CDX2,BPTF,MED14,UBB,SCAP,	1.52E-2
GO:0045941	positive regulation of transcription	E2F1,ILF2,EP300,ZXDC,XRCC6,GATA6,CDX2,BPTF,MED14,UBB,SCAP,	1.91E-2
GO:0006350	transcription	E2F1,NLK,NR2F1,KAT2B,ILF2,EP300,TAF5L,GATA6,CDX2,MED14,ZBTB4,CBX7,ZFHX3,RQCD1,ZNF526,ZXDC,ZBTB20,ZNF503,ARHGAP35,PLAG1,BPTF,TRRAP,SIRT1,DIDO1,	2.26E-2
GO:0010628	positive regulation of gene expression	E2F1,ILF2,EP300,ZXDC,XRCC6,GATA6,CDX2,BPTF,MED14,UBB,SCAP,	2.38E-2
GO:0016573	histone acetylation	KAT2B,EP300,TAF5L,TRRAP,	2.94E-2
GO:0006414	translational elongation	RPS8,RPS7,RPL18A,RPS12,UBB,	3.13E-2
GO:0006473	protein amino acid acetylation	KAT2B,EP300,TAF5L,TRRAP,	3.70E-2
GO:0006357	regulation of transcription from RNA polymerase II promoter	ZFHX3,E2F1,NR2F1,EP300,LMCD1,XRCC6,GATA6,CDX2,BPTF,MED14,SIRT1,SCAP,	3.90E-2
GO:0007568	aging	PTEN,BCL2,TIMP3,SIRT1,SCAP,	4.25E-2
GO:0018107	peptidyl-threonine phosphorylation	BCL2,NLK,MTOR,	5.09E-2
GO:0043543	protein amino acid acylation	KAT2B,EP300,TAF5L,TRRAP,	5.53E-2
GO:0016481	negative regulation of transcription	ZFHX3,E2F1,NR2F1,MAP3K10,LMCD1,ARHGAP35,CDX2,BPTF,SIRT1,	6.09E-2
GO:0018210	peptidyl-threonine modification	BCL2,NLK,MTOR,	6.90E-2
GO:0009890	negative regulation of biosynthetic process	ZFHX3,E2F1,NR2F1,MAP3K10,LMCD1,ARHGAP35,CDX2,BPTF,SIRT1,SCAP,	7.12E-2
GO:0032268	regulation of cellular protein metabolic process	EIF4E2,BCL2,EIF5A,EP300,MAP3K10,TIMP3,UBB,NRD1,MTOR,	7.34E-2
GO:0045893	positive regulation of transcription, DNA-dependent	E2F1,ILF2,EP300,XRCC6,GATA6,CDX2,BPTF,MED14,SCAP,	7.62E-2
GO:0051254	positive regulation of RNA metabolic process	E2F1,ILF2,EP300,XRCC6,GATA6,CDX2,BPTF,MED14,SCAP,	7.99E-2
GO:0032583	regulation of gene-specific transcription	XRCC6,GATA6,BPTF,SIRT1,SCAP,	8.50E-2
GO:0001101	response to acid	BCL2,TIMP3,MTOR,	8.97E-2
GO:0006915	apoptosis	PTEN,E2F1,BCL2,EP300,GATA6,XIAP,UBB,SIRT1,MCL1,DIDO1,	9.69E-2
GO:0048742	regulation of skeletal muscle fiber development	ZFHX3,BCL2,UBB,	9.71E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value