ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-145

MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0000437 hsa-miR-145-5p	GUCCAGUUUUCCCAGGAAUCCCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000461	MIPF0000079	CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU	MIMAT0004601 hsa-miR-145-3p	GGAUUCCUGGAAAUACUGUUCU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-145 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . The maturesequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

POU5F1P3,NRAS,SMAD2,PPM1D,MMP14,GOLM1,FAM3C,NDRG2,F11R,CDK4,VEGFA,MUC1,HOXA9,PTP4A2,ESR1
more » POU5F1P3,NRAS,SMAD2,PPM1D,MMP14,GOLM1,FAM3C,NDRG2,F11R,CDK4,VEGFA,MUC1,HOXA9,PTP4A2,ESR1,FLT1,CCDC43,ARL6IP5,RTKN,MYC,FZD7,CAMK2D,NEDD9,POU5F1P5,CTLA4,FSCN1,POU5F1,PHF17,NUDT1,MYO5A,AKR1B10,SOX9,CLINT1,TMOD3,ILK,FAM108C1,KRT7,DDX17,ROBO2,FLI1,LYPLA2,PPP3CA,MTMR14,GMFB,DFFA,FAM45A,TIRAP,C6orf115,SIRT1,CTGF,MIXL1,HDAC2,SOCS7,CEP19,PRC1,KREMEN1,TSPAN6,PODXL,EGFR,TPM3,MAP2K6,AP1G1,SOX2,ALDH3A1,SRGAP1,MMP12,IRS1,CDH2,RPS6KB1,PIGF,ITGB8,ERG,CDKN1A,EIF4E,APH1A,NIPSNAP1,DTD1,TP53,KLF4,CPEB4,CBFB,FOXP3,HIF1A,POU5F1B,IFNB1,YES1,KRT14,SWAP70,HLTF,CDK6,TPRG1,MEST,IRS2,SERINC5,MYO6,,IGF1R,BNIP3,ALPPL2,MDM2,POU5F1P4,SMAD3,C11orf9,SERPINE1,NDUFA4,TMEM9B,STAT1,PAK4,CASP3,NANOG,C11orf65,MMP1

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05200	Pathways in cancer	MMP1,EGFR,STAT1,HIF1A,CDK4,MDM2,CDKN1A,TP53,CASP3,IGF1R,CDK6,NRAS,VEGFA,FZD7,SMAD3,HDAC2,TPM3,MYC,SMAD2,	1.34E-9
hsa05219	Bladder cancer	NRAS,MMP1,VEGFA,EGFR,CDK4,MDM2,CDKN1A,TP53,MYC,	6.19E-9
hsa05214	Glioma	IGF1R,CDK6,NRAS,EGFR,CAMK2D,CDK4,MDM2,CDKN1A,TP53,	1.72E-7
hsa05220	Chronic myeloid leukemia	CDK6,NRAS,SMAD3,HDAC2,CDK4,MDM2,CDKN1A,TP53,MYC,	6.84E-7
hsa04115	p53 signaling pathway	CDK6,PPM1D,CDK4,MDM2,CDKN1A,CASP3,SERPINE1,TP53,	4.64E-6

hsa05218	Melanoma	IGF1R,CDK6,NRAS,EGFR,CDK4,MDM2,CDKN1A,TP53,	6.21E-6
hsa05212	Pancreatic cancer	CDK6,VEGFA,EGFR,STAT1,SMAD3,CDK4,TP53,SMAD2,	6.83E-6
hsa05210	Colorectal cancer	IGF1R,FZD7,EGFR,SMAD3,CASP3,TP53,MYC,SMAD2,	1.91E-5
hsa04110	Cell cycle	CDK6,SMAD3,HDAC2,CDK4,MDM2,CDKN1A,TP53,MYC,SMAD2,	3.23E-5
hsa04012	ErbB signaling pathway	PAK4,RPS6KB1,NRAS,EGFR,CAMK2D,CDKN1A,MYC,	2.28E-4
hsa05213	Endometrial cancer	NRAS,EGFR,ILK,TP53,MYC,	1.83E-2
hsa05215	Prostate cancer	IGF1R,NRAS,EGFR,MDM2,CDKN1A,TP53,	1.99E-2
hsa05223	Non-small cell lung cancer	CDK6,NRAS,EGFR,CDK4,TP53,	2.10E-2
hsa05216	Thyroid cancer	NRAS,TP53,MYC,TPM3,	3.05E-2
hsa04310	Wnt signaling pathway	FZD7,CAMK2D,SMAD3,TP53,MYC,PPP3CA,SMAD2,	4.09E-2
hsa04520	Adherens junction	IGF1R,EGFR,YES1,SMAD3,SMAD2,	7.59E-2
hsa04150	mTOR signaling pathway	RPS6KB1,VEGFA,HIF1A,EIF4E,	1.56E-1
hsa04510	Focal adhesion	PAK4,IGF1R,VEGFA,EGFR,ITGB8,FLT1,ILK,	1.58E-1
hsa05014	Amyotrophic lateral sclerosis (ALS)	MAP2K6,CASP3,TP53,PPP3CA,	1.64E-1
hsa04912	GnRH signaling pathway	NRAS,EGFR,CAMK2D,MAP2K6,MMP14,	1.73E-1
hsa04660	T cell receptor signaling pathway	PAK4,NRAS,CDK4,PPP3CA,CTLA4,	2.38E-1
hsa05120	Epithelial cell signaling in Helicobacter pylori infection	ADAM17,EGFR,CASP3,F11R,	3.17E-1
hsa05211	Renal cell carcinoma	PAK4,NRAS,VEGFA,HIF1A,	3.41E-1
hsa04722	Neurotrophin signaling pathway	NRAS,CAMK2D,IRS1,IRS2,TP53,	3.70E-1
hsa04360	Axon guidance	PAK4,NRAS,ROBO2,SRGAP1,PPP3CA,	4.19E-1
hsa04910	Insulin signaling pathway	RPS6KB1,NRAS,EIF4E,IRS1,IRS2,	4.82E-1
hsa04010	MAPK signaling pathway	NRAS,EGFR,MAP2K6,CASP3,TP53,MYC,PPP3CA,	5.32E-1
hsa05222	Small cell lung cancer	CDK6,CDK4,TP53,MYC,	5.38E-1
hsa04350	TGF-beta signaling pathway	RPS6KB1,SMAD3,MYC,SMAD2,	5.86E-1
hsa04210	Apoptosis	DFFA,CASP3,TP53,PPP3CA,	5.86E-1
hsa04330	Notch signaling pathway	ADAM17,HDAC2,APH1A,	8.28E-1
hsa04620	Toll-like receptor signaling pathway	TIRAP,IFNB1,STAT1,MAP2K6,	8.36E-1
hsa05010	Alzheimer's disease	ADAM17,NDUFA4,APH1A,CASP3,PPP3CA,	8.40E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0042127	regulation of cell proliferation	SOX2,STAT1,EGFR,CDKN1A,IGF1R,ADAM17,VEGFA,IFNB1,SOX9,FOXP3,PPM1D,CAMK2D,FLT1,HIF1A,MDM2,CDK4,ILK,IRS2,CASP3,SERPINE1,TP53,CDK6,RPS6KB1,NRAS,SMAD3,IRS1,KLF4,HDAC2,MMP12,SIRT1,MYC,SMAD2,CTLA4,	5.95E-17
GO:0008284	positive regulation of cell proliferation	SOX2,EGFR,CAMK2D,STAT1,HIF1A,FLT1,CDK4,MDM2,ILK,IRS2,CDKN1A,IGF1R,CDK6,RPS6KB1,NRAS,ADAM17,VEGFA,IRS1,HDAC2,MMP12,MYC,	5.54E-12
GO:0030335	positive regulation of cell migration	IGF1R,RPS6KB1,ADAM17,VEGFA,EGFR,FLT1,SMAD3,HIF1A,IRS1,ILK,IRS2,	5.21E-10
GO:0051272	positive regulation of cell motion	IGF1R,RPS6KB1,ADAM17,VEGFA,EGFR,FLT1,SMAD3,HIF1A,IRS1,ILK,IRS2,	1.36E-9
GO:0040017	positive regulation of locomotion	IGF1R,RPS6KB1,ADAM17,VEGFA,EGFR,FLT1,SMAD3,HIF1A,IRS1,ILK,IRS2,	1.36E-9

GO:0051325	interphase	CDK6,PPM1D,ADAM17,EGFR,CAMK2D,CDK4,MDM2,CDKN1A,KRT7,PPP3CA,	4.82E-8
GO:0040012	regulation of locomotion	IGF1R,RPS6KB1,ADAM17,VEGFA,IFNB1,EGFR,FLT1,SMAD3,HIF1A,IRS1,ILK,IRS2,	8.75E-8
GO:0030334	regulation of cell migration	IGF1R,RPS6KB1,ADAM17,VEGFA,EGFR,FLT1,SMAD3,HIF1A,IRS1,ILK,IRS2,	2.59E-7
GO:0051329	interphase of mitotic cell cycle	CDK6,PPM1D,ADAM17,EGFR,CAMK2D,CDK4,MDM2,CDKN1A,PPP3CA,	5.56E-7
GO:0048660	regulation of smooth muscle cell proliferation	RPS6KB1,VEGFA,EGFR,STAT1,FLT1,KLF4,ILK,	7.17E-7
GO:0051270	regulation of cell motion	IGF1R,RPS6KB1,ADAM17,VEGFA,EGFR,FLT1,SMAD3,HIF1A,IRS1,ILK,IRS2,	8.85E-7
GO:0031328	positive regulation of cellular biosynthetic process	SOX2,CBFB,EGFR,HIF1A,CDK4,IRS2,TP53,IGF1R,C11orf9,VEGFA,SMAD3,MYO6,IRS1,KLF4,HDAC2,MYC,FOXP3,SOX9,SMAD2,	9.24E-7
GO:0043066	negative regulation of apoptosis	EGFR,ESR1,ILK,BNIP3,CDKN1A,TP53,CASP3,IGF1R,DFFA,NRAS,ADAM17,VEGFA,SMAD3,MYC,	9.63E-7
GO:0043069	negative regulation of programmed cell death	EGFR,ESR1,ILK,BNIP3,CDKN1A,TP53,CASP3,IGF1R,DFFA,NRAS,ADAM17,VEGFA,SMAD3,MYC,	1.12E-6
GO:0009891	positive regulation of biosynthetic process	SOX2,CBFB,EGFR,HIF1A,CDK4,IRS2,TP53,IGF1R,C11orf9,VEGFA,SMAD3,MYO6,IRS1,KLF4,HDAC2,MYC,FOXP3,SOX9,SMAD2,	1.13E-6
GO:0060548	negative regulation of cell death	EGFR,ESR1,ILK,BNIP3,CDKN1A,TP53,CASP3,IGF1R,DFFA,NRAS,ADAM17,VEGFA,SMAD3,MYC,	1.16E-6
GO:0010604	positive regulation of macromolecule metabolic process	SOX2,CBFB,HIF1A,CDK4,MDM2,ESR1,IRS2,TP53,IGF1R,C11orf9,ADAM17,VEGFA,SMAD3,MYO6,IRS1,KLF4,HDAC2,MYC,SMAD2,FOXP3,SOX9,	1.33E-6
GO:0022402	cell cycle process	PPM1D,EGFR,NEDD9,CAMK2D,MDM2,CDK4,MAP2K6,ILK,KRT7,CDKN1A,TP53,PPP3CA,CDK6,ADAM17,SMAD3,PRC1,MYC,	1.54E-6
GO:0042981	regulation of apoptosis	EGFR,STAT1,ILK,MAP2K6,ESR1,BNIP3,CDKN1A,TP53,CASP3,APH1A,IGF1R,DFFA,NRAS,ADAM17,VEGFA,IFNB1,SMAD3,SIRT1,MYC,SOX9,	2.15E-6
GO:0010557	positive regulation of macromolecule biosynthetic process	SOX2,CBFB,HIF1A,CDK4,IRS2,TP53,IGF1R,C11orf9,VEGFA,SMAD3,MYO6,IRS1,KLF4,HDAC2,MYC,FOXP3,SOX9,SMAD2,	2.25E-6
GO:0043067	regulation of programmed cell death	EGFR,STAT1,ILK,MAP2K6,ESR1,BNIP3,CDKN1A,TP53,CASP3,APH1A,IGF1R,DFFA,NRAS,ADAM17,VEGFA,IFNB1,SMAD3,SIRT1,MYC,SOX9,	2.49E-6
GO:0010941	regulation of cell death	EGFR,STAT1,ILK,MAP2K6,ESR1,BNIP3,CDKN1A,TP53,CASP3,APH1A,IGF1R,DFFA,NRAS,ADAM17,VEGFA,IFNB1,SMAD3,SIRT1,MYC,SOX9,	2.62E-6
GO:0070482	response to oxygen levels	ADAM17,VEGFA,CAMK2D,FLT1,SMAD3,HIF1A,CDKN1A,BNIP3,MMP14,	5.97E-6
GO:0009628	response to abiotic stimulus	SOX2,PPM1D,STAT1,EGFR,KRT14,CDKN1A,TP53,CASP3,RPS6KB1,NRAS,HDAC2,MMP14,MYC,	8.80E-6
GO:0006793	phosphorus metabolic process	PPM1D,ALPPL2,NDUFA4,EGFR,CAMK2D,STAT1,YES1,FLT1,CDK4,ILK,MAP2K6,PTP4A2,GMFB,ERG,PPP3CA,PAK4,IGF1R,CDK6,RPS6KB1,MTMR14,SMAD2,	9.20E-6
GO:0006796	phosphate metabolic process	PPM1D,ALPPL2,NDUFA4,EGFR,CAMK2D,STAT1,YES1,FLT1,CDK4,ILK,MAP2K6,PTP4A2,GMFB,ERG,PPP3CA,PAK4,IGF1R,CDK6,RPS6KB1,MTMR14,SMAD2,	9.20E-6
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	SOX2,CBFB,HIF1A,TP53,VEGFA,MYO6,SMAD3,HDAC2,KLF4,MYC,FOXP3,SOX9,SMAD2,	9.55E-6
GO:0010647	positive regulation of cell communication	SOX2,ADAM17,NRAS,VEGFA,TMEM9B,EGFR,TSPAN6,FLT1,HIF1A,IRS1,ILK,ESR1,	1.70E-5
GO:0051726	regulation of cell cycle	CDK6,ADAM17,EGFR,CAMK2D,SMAD3,HDAC2,CDK4,MDM2,CDKN1A,CASP3,TP53,MYC,	1.79E-5
GO:0045786	negative regulation of cell cycle	CDK6,EGFR,SMAD3,HDAC2,CDKN1A,CASP3,TP53,	2.04E-5
GO:0045893	positive regulation of transcription, DNA-dependent	SOX2,CBFB,HIF1A,TP53,C11orf9,VEGFA,SMAD3,MYO6,HDAC2,KLF4,MYC,FOXP3,SOX9,SMAD2,	2.45E-5
GO:0051254	positive regulation of RNA metabolic process	SOX2,CBFB,HIF1A,TP53,C11orf9,VEGFA,SMAD3,MYO6,HDAC2,KLF4,MYC,FOXP3,SOX9,SMAD2,	2.68E-5
GO:0010033	response to organic substance	EGFR,STAT1,ESR1,IRS2,CDKN1A,CASP3,PPP3CA,IGF1R,RPS6KB1,ADAM17,SMAD3,IRS1,HDAC2,SOCS7,MMP14,MYC,SMAD2,	3.33E-5
GO:0051173	positive regulation of nitrogen compound metabolic process	SOX2,CBFB,EGFR,HIF1A,TP53,IGF1R,C11orf9,VEGFA,SMAD3,MYO6,HDAC2,KLF4,MYC,FOXP3,SOX9,SMAD2,	3.48E-5
GO:0009967	positive regulation of signal transduction	SOX2,ADAM17,NRAS,VEGFA,TMEM9B,TSPAN6,FLT1,HIF1A,IRS1,ILK,ESR1,	3.74E-5
GO:0008285	negative regulation of cell proliferation	CDK6,PPM1D,IFNB1,SMAD3,KLF4,ILK,CDKN1A,CASP3,TP53,SMAD2,FOXP3,CTLA4,	3.99E-5
GO:0001666	response to hypoxia	ADAM17,VEGFA,CAMK2D,FLT1,SMAD3,HIF1A,BNIP3,MMP14,	3.99E-5
GO:0000082	G1/S transition of mitotic cell cycle	ADAM17,EGFR,CAMK2D,CDK4,CDKN1A,PPP3CA,	4.20E-5
GO:0010628	positive regulation of gene expression	SOX2,CBFB,HIF1A,ESR1,TP53,C11orf9,VEGFA,SMAD3,MYO6,HDAC2,KLF4,MYC,FOXP3,SOX9,SMAD2,	4.53E-5
GO:0048661	positive regulation of smooth muscle cell proliferation	RPS6KB1,VEGFA,EGFR,STAT1,FLT1,	5.95E-5
GO:0043085	positive regulation of catalytic activity	STAT1,EGFR,HIF1A,FLT1,MAP2K6,ILK,TP53,APH1A,SERINC5,ADAM17,IFNB1,SMAD3,IRS1,MYC,	5.99E-5
GO:0007569	cell aging	NRAS,ILK,SIRT1,SERPINE1,TP53,	7.66E-5
GO:0007049	cell cycle	PPM1D,EGFR,NEDD9,CAMK2D,MDM2,CDK4,MAP2K6,ILK,KRT7,CDKN1A,TP53,PPP3CA,CDK6,ADAM17,SMAD3,PRC1,MYC,	8.03E-5
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	SOX2,CBFB,HIF1A,TP53,IGF1R,C11orf9,VEGFA,SMAD3,MYO6,HDAC2,KLF4,MYC,FOXP3,SOX9,SMAD2,	9.76E-5
GO:0016310	phosphorylation	ALPPL2,NDUFA4,EGFR,CAMK2D,STAT1,YES1,FLT1,CDK4,ILK,MAP2K6,GMFB,ERG,PAK4,IGF1R,CDK6,RPS6KB1,SMAD2,	1.14E-4
GO:0040008	regulation of growth	RPS6KB1,ADAM17,PHF17,CAMK2D,NEDD9,SMAD3,CTGF,ILK,CDKN1A,SOCS7,TP53,	1.25E-4
GO:0007167	enzyme linked receptor protein signaling pathway	IGF1R,ADAM17,VEGFA,EGFR,FLT1,SMAD3,CTGF,IRS1,IRS2,SOCS7,SMAD2,	1.28E-4
GO:0045941	positive regulation of transcription	SOX2,CBFB,HIF1A,TP53,C11orf9,VEGFA,SMAD3,MYO6,HDAC2,KLF4,MYC,FOXP3,SOX9,SMAD2,	1.35E-4
GO:0022403	cell cycle phase	CDK6,PPM1D,ADAM17,EGFR,CAMK2D,NEDD9,CDK4,MDM2,CDKN1A,KRT7,PRC1,PPP3CA,	1.36E-4
GO:0006357	regulation of transcription from RNA polymerase II promoter	SOX2,CBFB,HLTF,HIF1A,MDM2,TP53,VEGFA,SMAD3,MYO6,KLF4,HDAC2,MYC,SIRT1,FOXP3,SOX9,SMAD2,	1.36E-4
GO:0032844	regulation of homeostatic process	CDK6,ADAM17,C11orf9,VEGFA,HIF1A,MYC,CDH2,	1.39E-4
GO:0009991	response to extracellular stimulus	SOX2,RPS6KB1,STAT1,MUC1,KLF4,CDKN1A,SIRT1,MEST,TP53,	1.44E-4
GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	IGF1R,ADAM17,VEGFA,EGFR,FLT1,CTGF,IRS1,IRS2,SOCS7,	1.63E-4
GO:0010629	negative regulation of gene expression	SOX2,MDM2,BNIP3,TP53,IFNB1,SMAD3,HDAC2,KLF4,MYC,SIRT1,FOXP3,SOX9,SMAD2,	1.85E-4
GO:0006468	protein amino acid phosphorylation	EGFR,CAMK2D,STAT1,YES1,FLT1,CDK4,MAP2K6,ILK,GMFB,ERG,PAK4,IGF1R,CDK6,RPS6KB1,SMAD2,	1.96E-4
GO:0044093	positive regulation of molecular function	STAT1,EGFR,HIF1A,FLT1,MAP2K6,ILK,TP53,APH1A,SERINC5,ADAM17,IFNB1,SMAD3,IRS1,MYC,	1.98E-4
GO:0048878	chemical homeostasis	CAMK2D,HIF1A,IRS2,ILK,BNIP3,TP53,SERPINE1,PPP3CA,SERINC5,C11orf9,VEGFA,IRS1,MYC,	2.15E-4
GO:0000278	mitotic cell cycle	CDK6,PPM1D,ADAM17,EGFR,CAMK2D,NEDD9,CDK4,MDM2,CDKN1A,PRC1,PPP3CA,	2.43E-4
GO:0006309	DNA fragmentation involved in apoptosis	DFFA,BNIP3,CASP3,MYC,	2.90E-4
GO:0032583	regulation of gene-specific transcription	SMAD3,HIF1A,HDAC2,SIRT1,TP53,SMAD2,FOXP3,	3.36E-4
GO:0006355	regulation of transcription, DNA-dependent	SOX2,CBFB,STAT1,HLTF,ESR1,FLI1,ERG,C11orf9,VEGFA,POU5F1B,POU5F1,FOXP3,SOX9,MIXL1,HOXA9,HIF1A,MDM2,TP53,NANOG,SMAD3,MYO6,HDAC2,KLF4,MYC,SIRT1,SMAD2,	3.39E-4
GO:0043193	positive regulation of gene-specific transcription	SMAD3,HIF1A,HDAC2,TP53,SMAD2,FOXP3,	3.43E-4
GO:0006917	induction of apoptosis	DFFA,IFNB1,STAT1,SMAD3,CDKN1A,BNIP3,APH1A,CASP3,TP53,MYC,	3.77E-4
GO:0012502	induction of programmed cell death	DFFA,IFNB1,STAT1,SMAD3,CDKN1A,BNIP3,APH1A,CASP3,TP53,MYC,	3.86E-4
GO:0001836	release of cytochrome c from mitochondria	SMAD3,CASP3,TP53,MYC,	3.94E-4
GO:0001558	regulation of cell growth	ADAM17,PHF17,CAMK2D,SMAD3,CTGF,ILK,CDKN1A,TP53,	3.99E-4
GO:0031667	response to nutrient levels	SOX2,RPS6KB1,STAT1,MUC1,KLF4,SIRT1,MEST,TP53,	4.38E-4
GO:0006928	cell motion	PAK4,MIXL1,RPS6KB1,ADAM17,ROBO2,FLT1,HIF1A,CTGF,PODXL,MMP14,CDH2,TPM3,	4.43E-4
GO:0051252	regulation of RNA metabolic process	SOX2,CBFB,STAT1,HLTF,ESR1,FLI1,ERG,C11orf9,VEGFA,POU5F1B,POU5F1,FOXP3,SOX9,MIXL1,HOXA9,HIF1A,MDM2,TP53,NANOG,SMAD3,MYO6,HDAC2,KLF4,MYC,SIRT1,SMAD2,	4.77E-4
GO:0009314	response to radiation	PPM1D,NRAS,EGFR,KRT14,CDKN1A,CASP3,TP53,MYC,	4.80E-4
GO:0009719	response to endogenous stimulus	IGF1R,RPS6KB1,ADAM17,STAT1,IRS1,IRS2,ESR1,CDKN1A,SOCS7,MMP14,PPP3CA,	4.97E-4
GO:0006921	cell structure disassembly during apoptosis	DFFA,BNIP3,CASP3,MYC,	5.20E-4
GO:0006919	activation of caspase activity	IFNB1,STAT1,SMAD3,TP53,MYC,	5.30E-4
GO:0009612	response to mechanical stimulus	SOX2,RPS6KB1,STAT1,MMP14,MYC,	6.09E-4
GO:0042592	homeostatic process	CAMK2D,HIF1A,ILK,IRS2,BNIP3,TP53,SERPINE1,CASP3,PPP3CA,SERINC5,C11orf9,VEGFA,IRS1,MYC,FOXP3,	6.51E-4
GO:0032868	response to insulin stimulus	IGF1R,RPS6KB1,STAT1,IRS1,IRS2,SOCS7,	6.51E-4
GO:0016477	cell migration	MIXL1,RPS6KB1,ADAM17,FLT1,HIF1A,CTGF,PODXL,MMP14,CDH2,	6.63E-4
GO:0010952	positive regulation of peptidase activity	IFNB1,STAT1,SMAD3,TP53,MYC,	7.42E-4
GO:0043280	positive regulation of caspase activity	IFNB1,STAT1,SMAD3,TP53,MYC,	7.42E-4
GO:0007050	cell cycle arrest	SMAD3,ILK,MAP2K6,CDKN1A,TP53,MYC,	7.44E-4
GO:0000737	DNA catabolic process, endonucleolytic	DFFA,BNIP3,CASP3,MYC,	7.52E-4
GO:0030262	apoptotic nuclear changes	DFFA,BNIP3,CASP3,MYC,	7.52E-4
GO:0042493	response to drug	RPS6KB1,ADAM17,STAT1,HDAC2,MAP2K6,CDKN1A,MMP12,TP53,	7.58E-4
GO:0045596	negative regulation of cell differentiation	SOX2,CDK6,SMAD3,KLF4,SIRT1,TP53,SOX9,CTLA4,	7.58E-4
GO:0043065	positive regulation of apoptosis	DFFA,IFNB1,STAT1,SMAD3,MAP2K6,CDKN1A,BNIP3,APH1A,CASP3,TP53,MYC,	7.90E-4
GO:0045892	negative regulation of transcription, DNA-dependent	SOX2,SMAD3,KLF4,HDAC2,MDM2,SIRT1,TP53,SOX9,SMAD2,FOXP3,	8.13E-4
GO:0043068	positive regulation of programmed cell death	DFFA,IFNB1,STAT1,SMAD3,MAP2K6,CDKN1A,BNIP3,APH1A,CASP3,TP53,MYC,	8.34E-4
GO:0001952	regulation of cell-matrix adhesion	CDK6,SMAD3,ILK,MMP14,	8.42E-4
GO:0010942	positive regulation of cell death	DFFA,IFNB1,STAT1,SMAD3,MAP2K6,CDKN1A,BNIP3,APH1A,CASP3,TP53,MYC,	8.63E-4
GO:0008283	cell proliferation	VEGFA,IFNB1,NANOG,EGFR,FSCN1,ILK,IRS2,MMP14,ERG,TP53,MYC,	8.79E-4
GO:0051253	negative regulation of RNA metabolic process	SOX2,SMAD3,KLF4,HDAC2,MDM2,SIRT1,TP53,SOX9,SMAD2,FOXP3,	9.15E-4
GO:0006915	apoptosis	STAT1,RTKN,BNIP3,TP53,CASP3,APH1A,DFFA,NRAS,PHF17,IFNB1,SMAD3,MYC,SIRT1,	9.17E-4
GO:0030949	positive regulation of vascular endothelial growth factor receptor signaling pathway	VEGFA,FLT1,HIF1A,	9.80E-4
GO:0007568	aging	RPS6KB1,NRAS,ILK,SIRT1,SERPINE1,TP53,	1.00E-2
GO:0012501	programmed cell death	STAT1,RTKN,BNIP3,TP53,CASP3,APH1A,DFFA,NRAS,PHF17,IFNB1,SMAD3,MYC,SIRT1,	1.04E-2
GO:0032869	cellular response to insulin stimulus	IGF1R,STAT1,IRS1,IRS2,SOCS7,	1.26E-2
GO:0008637	apoptotic mitochondrial changes	SMAD3,CASP3,TP53,MYC,	1.26E-2
GO:0016481	negative regulation of transcription	SOX2,IFNB1,SMAD3,KLF4,HDAC2,MDM2,SIRT1,TP53,SOX9,SMAD2,FOXP3,	1.29E-2
GO:0051674	localization of cell	MIXL1,RPS6KB1,ADAM17,FLT1,HIF1A,CTGF,PODXL,MMP14,CDH2,	1.31E-2
GO:0048870	cell motility	MIXL1,RPS6KB1,ADAM17,FLT1,HIF1A,CTGF,PODXL,MMP14,CDH2,	1.31E-2
GO:0048598	embryonic morphogenesis	SOX2,MIXL1,HOXA9,SMAD3,MYO6,KLF4,TP53,MYC,SMAD2,	1.31E-2
GO:0010720	positive regulation of cell development	SOX2,ROBO2,SMAD3,ILK,SMAD2,	1.33E-2
GO:0044057	regulation of system process	RPS6KB1,C11orf9,NRAS,EGFR,FLT1,MYO6,CDH2,TPM3,PPP3CA,	1.37E-2
GO:0007369	gastrulation	MIXL1,SMAD3,KLF4,TP53,SMAD2,	1.41E-2
GO:0050678	regulation of epithelial cell proliferation	CDK6,VEGFA,EGFR,SMAD3,MMP12,	1.48E-2
GO:0032526	response to retinoic acid	SOX2,MUC1,KLF4,MEST,	1.52E-2
GO:0060348	bone development	CBFB,EGFR,SMAD3,CTGF,MMP14,SOX9,	1.64E-2
GO:0030947	regulation of vascular endothelial growth factor receptor signaling pathway	VEGFA,FLT1,HIF1A,	1.66E-2
GO:0001954	positive regulation of cell-matrix adhesion	CDK6,SMAD3,ILK,	1.66E-2
GO:0007498	mesoderm development	VEGFA,SMAD3,KLF4,MEST,SMAD2,	1.73E-2
GO:0048145	regulation of fibroblast proliferation	CDK6,CDK4,CDKN1A,TP53,	1.81E-2
GO:0031331	positive regulation of cellular catabolic process	HIF1A,IRS1,MDM2,IRS2,	1.96E-2
GO:0010769	regulation of cell morphogenesis involved in differentiation	ROBO2,SMAD3,ILK,CDH2,SMAD2,	2.00E-2
GO:0008286	insulin receptor signaling pathway	IGF1R,IRS1,IRS2,SOCS7,	2.12E-2
GO:0022604	regulation of cell morphogenesis	VEGFA,ROBO2,SMAD3,ILK,CDH2,SMAD2,	2.17E-2
GO:0043281	regulation of caspase activity	IFNB1,STAT1,SMAD3,TP53,MYC,	2.20E-2
GO:0032870	cellular response to hormone stimulus	IGF1R,RPS6KB1,STAT1,IRS1,IRS2,SOCS7,	2.32E-2
GO:0048732	gland development	SOX2,IGF1R,HOXA9,EGFR,IRS1,IRS2,	2.47E-2
GO:0052548	regulation of endopeptidase activity	IFNB1,STAT1,SMAD3,TP53,MYC,	2.52E-2
GO:0046649	lymphocyte activation	ADAM17,IFNB1,CBFB,SMAD3,SWAP70,TP53,FOXP3,	2.61E-2
GO:0001704	formation of primary germ layer	MIXL1,SMAD3,KLF4,SMAD2,	2.66E-2
GO:0045165	cell fate commitment	SOX2,KLF4,CASP3,TP53,SOX9,SMAD2,	2.81E-2
GO:0045934	negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	SOX2,IFNB1,SMAD3,KLF4,HDAC2,MDM2,SIRT1,TP53,SOX9,SMAD2,FOXP3,	2.89E-2
GO:0007584	response to nutrient	SOX2,RPS6KB1,STAT1,MUC1,KLF4,MEST,	2.90E-2
GO:0052547	regulation of peptidase activity	IFNB1,STAT1,SMAD3,TP53,MYC,	3.00E-2
GO:0060284	regulation of cell development	SOX2,ROBO2,SMAD3,ILK,TP53,CDH2,SMAD2,	3.03E-2
GO:0033189	response to vitamin A	SOX2,MUC1,KLF4,MEST,	3.06E-2
GO:0002520	immune system development	CDK6,ADAM17,TIRAP,HOXA9,VEGFA,CBFB,SWAP70,TP53,	3.08E-2
GO:0008361	regulation of cell size	ADAM17,PHF17,SMAD3,CDK4,ILK,CDKN1A,TP53,	3.10E-2
GO:0051172	negative regulation of nitrogen compound metabolic process	SOX2,IFNB1,SMAD3,KLF4,HDAC2,MDM2,SIRT1,TP53,SOX9,SMAD2,FOXP3,	3.18E-2
GO:0051969	regulation of transmission of nerve impulse	C11orf9,NRAS,EGFR,MYO6,CDH2,PPP3CA,	3.57E-2
GO:0001775	cell activation	ADAM17,IFNB1,CBFB,EGFR,SMAD3,SWAP70,TP53,FOXP3,	3.82E-2
GO:0010810	regulation of cell-substrate adhesion	CDK6,SMAD3,ILK,MMP14,	3.97E-2
GO:0009725	response to hormone stimulus	IGF1R,RPS6KB1,STAT1,IRS1,IRS2,ESR1,CDKN1A,SOCS7,MMP14,	3.98E-2
GO:0008219	cell death	STAT1,RTKN,BNIP3,TP53,CASP3,APH1A,DFFA,NRAS,PHF17,IFNB1,SMAD3,MYC,SIRT1,	4.03E-2
GO:0045668	negative regulation of osteoblast differentiation	SOX2,CDK6,SMAD3,	4.11E-2
GO:0007346	regulation of mitotic cell cycle	EGFR,CAMK2D,SMAD3,MDM2,TP53,MYC,	4.12E-2
GO:0010551	regulation of specific transcription from RNA polymerase II promoter	SMAD3,HDAC2,SIRT1,TP53,FOXP3,	4.13E-2
GO:0031644	regulation of neurological system process	C11orf9,NRAS,EGFR,MYO6,CDH2,PPP3CA,	4.24E-2
GO:0016265	death	STAT1,RTKN,BNIP3,TP53,CASP3,APH1A,DFFA,NRAS,PHF17,IFNB1,SMAD3,MYC,SIRT1,	4.26E-2
GO:0035295	tube development	VEGFA,ROBO2,FLT1,CTGF,ILK,MMP14,SMAD2,	4.28E-2
GO:0051338	regulation of transferase activity	SERINC5,ADAM17,EGFR,FLT1,IRS1,ILK,MAP2K6,CDKN1A,CASP3,	4.31E-2
GO:0043434	response to peptide hormone stimulus	IGF1R,RPS6KB1,STAT1,IRS1,IRS2,SOCS7,	4.36E-2
GO:0010558	negative regulation of macromolecule biosynthetic process	SOX2,IFNB1,SMAD3,KLF4,HDAC2,MDM2,SIRT1,TP53,SOX9,SMAD2,FOXP3,	4.61E-2
GO:0009896	positive regulation of catabolic process	HIF1A,IRS1,MDM2,IRS2,	4.75E-2
GO:0010605	negative regulation of macromolecule metabolic process	SOX2,MDM2,BNIP3,TP53,IFNB1,SMAD3,HDAC2,KLF4,MYC,SIRT1,FOXP3,SOX9,SMAD2,	4.75E-2
GO:0031327	negative regulation of cellular biosynthetic process	SOX2,IFNB1,SMAD3,KLF4,HDAC2,MDM2,SIRT1,TP53,SOX9,SMAD2,FOXP3,	5.50E-2
GO:0051291	protein heterooligomerization	IGF1R,IRS1,ILK,CDH2,	5.61E-2
GO:0006997	nucleus organization	DFFA,BNIP3,CASP3,MYC,	5.61E-2
GO:0006979	response to oxidative stress	NUDT1,EGFR,STAT1,HIF1A,MMP14,SERPINE1,	5.68E-2
GO:0022411	cellular component disassembly	DFFA,BNIP3,CASP3,MYC,	5.92E-2
GO:0030097	hemopoiesis	CDK6,ADAM17,TIRAP,HOXA9,VEGFA,CBFB,TP53,	6.00E-2
GO:0002053	positive regulation of mesenchymal cell proliferation	VEGFA,IRS1,IRS2,	6.07E-2
GO:0008629	induction of apoptosis by intracellular signals	CDKN1A,CASP3,TP53,MYC,	6.23E-2
GO:0000079	regulation of cyclin-dependent protein kinase activity	ADAM17,EGFR,CDKN1A,CASP3,	6.23E-2
GO:0009890	negative regulation of biosynthetic process	SOX2,IFNB1,SMAD3,KLF4,HDAC2,MDM2,SIRT1,TP53,SOX9,SMAD2,FOXP3,	6.36E-2
GO:0051347	positive regulation of transferase activity	SERINC5,ADAM17,EGFR,FLT1,IRS1,ILK,MAP2K6,	6.50E-2
GO:0001501	skeletal system development	HOXA9,CBFB,EGFR,SMAD3,CTGF,MMP14,MYC,SOX9,	6.74E-2
GO:0060541	respiratory system development	SOX2,VEGFA,CTGF,MMP14,SMAD2,	6.75E-2
GO:0045321	leukocyte activation	ADAM17,IFNB1,CBFB,SMAD3,SWAP70,TP53,FOXP3,	6.77E-2
GO:0010464	regulation of mesenchymal cell proliferation	VEGFA,IRS1,IRS2,	6.79E-2
GO:0006338	chromatin remodeling	HDAC2,BNIP3,SIRT1,FOXP3,	6.90E-2
GO:0016458	gene silencing	SMAD3,HDAC2,SIRT1,SMAD2,	6.90E-2
GO:0010552	positive regulation of specific transcription from RNA polymerase II promoter	SMAD3,HDAC2,TP53,FOXP3,	7.24E-2
GO:0010907	positive regulation of glucose metabolic process	HIF1A,IRS1,IRS2,	7.56E-2
GO:0009411	response to UV	EGFR,CDKN1A,CASP3,TP53,	7.97E-2
GO:0051345	positive regulation of hydrolase activity	IFNB1,EGFR,STAT1,SMAD3,TP53,MYC,	8.16E-2
GO:0006308	DNA catabolic process	DFFA,BNIP3,CASP3,MYC,	8.35E-2
GO:0010676	positive regulation of cellular carbohydrate metabolic process	HIF1A,IRS1,IRS2,	8.36E-2
GO:0045913	positive regulation of carbohydrate metabolic process	HIF1A,IRS1,IRS2,	8.36E-2
GO:0001503	ossification	CBFB,EGFR,SMAD3,CTGF,MMP14,	8.40E-2
GO:0006259	DNA metabolic process	DFFA,NUDT1,CTGF,SWAP70,KRT7,BNIP3,SIRT1,CASP3,TP53,MYC,	8.49E-2
GO:0031329	regulation of cellular catabolic process	HIF1A,IRS1,MDM2,IRS2,	8.74E-2
GO:0045884	regulation of survival gene product expression	ESR1,BNIP3,MYC,	9.20E-2
GO:0048534	hemopoietic or lymphoid organ development	CDK6,ADAM17,TIRAP,HOXA9,VEGFA,CBFB,TP53,	9.47E-2
GO:0030879	mammary gland development	IGF1R,HOXA9,IRS1,IRS2,	9.55E-2
GO:0003006	reproductive developmental process	SOX2,IGF1R,RPS6KB1,VEGFA,MMP14,SIRT1,SOX9,	9.81E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value