ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-106b-5p

MI0000113	MIPF0000001	CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAAGCACUUCUUACAUUACCAUGG	MIMAT0000103 hsa-miR-106a-5p	AAAAGUGCUUACAGUGCAGGUAG	This miRNA was not cloned in reference , rather it was identified byhomology to miR-91 (MIR:MI0000071). This sequence is localised tochromosome X and was named mir-106-X in . Mouse and human miR-106a(MIR:MI0000406 and MIR:MI0000113) differ at two positions but theprecursor sequences are clearly closely related. The sequences are alsorelated to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000113	MIPF0000001	CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAAGCACUUCUUACAUUACCAUGG	MIMAT0000103 hsa-miR-106a-5p	AAAAGUGCUUACAGUGCAGGUAG	This miRNA was not cloned in reference , rather it was identified byhomology to miR-91 (MIR:MI0000071). This sequence is localised tochromosome X and was named mir-106-X in . Mouse and human miR-106a(MIR:MI0000406 and MIR:MI0000113) differ at two positions but theprecursor sequences are clearly closely related. The sequences are alsorelated to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000113	MIPF0000001	CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAAGCACUUCUUACAUUACCAUGG	MIMAT0000103 hsa-miR-106a-5p	AAAAGUGCUUACAGUGCAGGUAG	This miRNA was not cloned in reference , rather it was identified byhomology to miR-91 (MIR:MI0000071). This sequence is localised tochromosome X and was named mir-106-X in . Mouse and human miR-106a(MIR:MI0000406 and MIR:MI0000113) differ at two positions but theprecursor sequences are clearly closely related. The sequences are alsorelated to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000113	MIPF0000001	CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAAGCACUUCUUACAUUACCAUGG	MIMAT0000103 hsa-miR-106a-5p	AAAAGUGCUUACAGUGCAGGUAG	This miRNA was not cloned in reference , rather it was identified byhomology to miR-91 (MIR:MI0000071). This sequence is localised tochromosome X and was named mir-106-X in . Mouse and human miR-106a(MIR:MI0000406 and MIR:MI0000113) differ at two positions but theprecursor sequences are clearly closely related. The sequences are alsorelated to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

RAD23B,KAT2B,ARID4B,RDH11,ARL9,CKAP2,VEGFA,DLST,VDAC1,RTCD1,HIPK3,CUL4A,GNB1,CASP8,CHST14
more » RAD23B,KAT2B,ARID4B,RDH11,ARL9,CKAP2,VEGFA,DLST,VDAC1,RTCD1,HIPK3,CUL4A,GNB1,CASP8,CHST14,RBL2,CYB561D1,ITCH,HOXC11,CYP19A1,PRRC2A,APP,IL10,TTLL12,SEPT2,EIF4G2,SIRPA,TFG,NOTCH2,FAS,RNF182,DCBLD2,PRPF8,HDHD1,PPP2R1A,HEATR1,EIF2C1,MTF1,RUNX1,MYLIP,EIF3M,CDKN1A,PELI1,KPNA2,RBL1,E2F1,COL2A1,ZBTB47,SMG1,MTMR3,XIAP,WEE1,RPH3A,APC,TCEAL1,RB1,ARHGAP5,CHTF8,ZNF598,RTN3,CCDC47,SDHA,SIPA1L3

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05200	Pathways in cancer	RUNX1,FAS,CASP8,E2F1,TFG,VEGFA,APC,RB1,XIAP,CDKN1A,	9.82E-5
hsa04110	Cell cycle	E2F1,RBL2,RBL1,WEE1,RB1,CDKN1A,	8.42E-4
hsa05219	Bladder cancer	E2F1,VEGFA,RB1,CDKN1A,	2.00E-2
hsa05220	Chronic myeloid leukemia	RUNX1,E2F1,RB1,CDKN1A,	1.03E-1
hsa05214	Glioma	E2F1,RB1,CDKN1A,	5.58E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0007049	cell cycle	E2F1,KAT2B,NOTCH2,KPNA2,APC,SEPT2,WEE1,RB1,CDKN1A,CKAP2,APP,EIF4G2,CHTF8,CUL4A,RBL2,RBL1,	2.88E-7
GO:0007050	cell cycle arrest	EIF4G2,NOTCH2,KAT2B,CUL4A,APC,RB1,CDKN1A,	3.60E-6
GO:0022402	cell cycle process	EIF4G2,E2F1,NOTCH2,KAT2B,KPNA2,CUL4A,APC,SEPT2,WEE1,RB1,CDKN1A,APP,	1.37E-5
GO:0030097	hemopoiesis	RUNX1,FAS,CASP8,VEGFA,NOTCH2,APC,RB1,IL10,	4.47E-5
GO:0051329	interphase of mitotic cell cycle	E2F1,KPNA2,CUL4A,RB1,CDKN1A,APP,	5.96E-5

GO:0051325	interphase	E2F1,KPNA2,CUL4A,RB1,CDKN1A,APP,	6.84E-5
GO:0042981	regulation of apoptosis	COL2A1,CASP8,NOTCH2,APC,XIAP,CDKN1A,APP,FAS,VEGFA,PPP2R1A,CUL4A,IL10,HIPK3,	7.33E-5
GO:0043067	regulation of programmed cell death	COL2A1,CASP8,NOTCH2,APC,XIAP,CDKN1A,APP,FAS,VEGFA,PPP2R1A,CUL4A,IL10,HIPK3,	8.06E-5
GO:0048534	hemopoietic or lymphoid organ development	RUNX1,FAS,CASP8,VEGFA,NOTCH2,APC,RB1,IL10,	8.24E-5
GO:0010941	regulation of cell death	COL2A1,CASP8,NOTCH2,APC,XIAP,CDKN1A,APP,FAS,VEGFA,PPP2R1A,CUL4A,IL10,HIPK3,	8.35E-5
GO:0043066	negative regulation of apoptosis	COL2A1,FAS,VEGFA,NOTCH2,APC,XIAP,CDKN1A,IL10,HIPK3,	8.45E-5
GO:0043069	negative regulation of programmed cell death	COL2A1,FAS,VEGFA,NOTCH2,APC,XIAP,CDKN1A,IL10,HIPK3,	9.31E-5
GO:0060548	negative regulation of cell death	COL2A1,FAS,VEGFA,NOTCH2,APC,XIAP,CDKN1A,IL10,HIPK3,	9.50E-5
GO:0000278	mitotic cell cycle	E2F1,KPNA2,CUL4A,APC,SEPT2,WEE1,RB1,CDKN1A,APP,	1.14E-4
GO:0002520	immune system development	RUNX1,FAS,CASP8,VEGFA,NOTCH2,APC,RB1,IL10,	1.19E-4
GO:0008361	regulation of cell size	DCBLD2,NOTCH2,PPP2R1A,ARHGAP5,RB1,CDKN1A,APP,	1.80E-4
GO:0022403	cell cycle phase	E2F1,KPNA2,CUL4A,APC,SEPT2,WEE1,RB1,CDKN1A,APP,	2.48E-4
GO:0043065	positive regulation of apoptosis	FAS,CASP8,NOTCH2,PPP2R1A,CUL4A,APC,CDKN1A,IL10,APP,	3.20E-4
GO:0043068	positive regulation of programmed cell death	FAS,CASP8,NOTCH2,PPP2R1A,CUL4A,APC,CDKN1A,IL10,APP,	3.35E-4
GO:0010942	positive regulation of cell death	FAS,CASP8,NOTCH2,PPP2R1A,CUL4A,APC,CDKN1A,IL10,APP,	3.46E-4
GO:0006469	negative regulation of protein kinase activity	PPP2R1A,APC,RB1,CDKN1A,HIPK3,	4.23E-4
GO:0033673	negative regulation of kinase activity	PPP2R1A,APC,RB1,CDKN1A,HIPK3,	4.82E-4
GO:0043549	regulation of kinase activity	PPP2R1A,RBL2,RBL1,APC,RB1,CDKN1A,HIPK3,APP,	5.73E-4
GO:0008285	negative regulation of cell proliferation	NOTCH2,KAT2B,CUL4A,APC,RB1,ITCH,CDKN1A,IL10,	6.12E-4
GO:0051348	negative regulation of transferase activity	PPP2R1A,APC,RB1,CDKN1A,HIPK3,	6.15E-4
GO:0043550	regulation of lipid kinase activity	RBL2,RBL1,RB1,	7.15E-4
GO:0051338	regulation of transferase activity	PPP2R1A,RBL2,RBL1,APC,RB1,CDKN1A,HIPK3,APP,	7.31E-4
GO:0032535	regulation of cellular component size	DCBLD2,NOTCH2,PPP2R1A,ARHGAP5,RB1,CDKN1A,APP,	7.78E-4
GO:0006916	anti-apoptosis	FAS,VEGFA,NOTCH2,XIAP,IL10,HIPK3,	1.46E-2
GO:0006917	induction of apoptosis	FAS,CASP8,NOTCH2,PPP2R1A,CUL4A,CDKN1A,APP,	1.82E-2
GO:0012502	induction of programmed cell death	FAS,CASP8,NOTCH2,PPP2R1A,CUL4A,CDKN1A,APP,	1.85E-2
GO:0008219	cell death	EIF4G2,FAS,CASP8,E2F1,RTN3,VDAC1,XIAP,CKAP2,HIPK3,APP,	2.26E-2
GO:0016265	death	EIF4G2,FAS,CASP8,E2F1,RTN3,VDAC1,XIAP,CKAP2,HIPK3,APP,	2.37E-2
GO:0042325	regulation of phosphorylation	PPP2R1A,RBL2,RBL1,APC,RB1,CDKN1A,HIPK3,APP,	2.67E-2
GO:0006915	apoptosis	FAS,CASP8,E2F1,RTN3,VDAC1,XIAP,CKAP2,HIPK3,APP,	2.81E-2
GO:0045637	regulation of myeloid cell differentiation	RUNX1,FAS,APC,RB1,	2.87E-2
GO:0012501	programmed cell death	FAS,CASP8,E2F1,RTN3,VDAC1,XIAP,CKAP2,HIPK3,APP,	3.08E-2
GO:0051174	regulation of phosphorus metabolic process	PPP2R1A,RBL2,RBL1,APC,RB1,CDKN1A,HIPK3,APP,	3.33E-2
GO:0019220	regulation of phosphate metabolic process	PPP2R1A,RBL2,RBL1,APC,RB1,CDKN1A,HIPK3,APP,	3.33E-2
GO:0042127	regulation of cell proliferation	VEGFA,NOTCH2,KAT2B,ARHGAP5,CUL4A,APC,RB1,ITCH,CDKN1A,IL10,	4.15E-2
GO:0030308	negative regulation of cell growth	DCBLD2,PPP2R1A,RB1,CDKN1A,	6.18E-2
GO:0030099	myeloid cell differentiation	RUNX1,CASP8,VEGFA,RB1,	6.37E-2
GO:0045792	negative regulation of cell size	DCBLD2,PPP2R1A,RB1,CDKN1A,	7.57E-2
GO:0001558	regulation of cell growth	DCBLD2,PPP2R1A,RB1,ITCH,CDKN1A,	7.90E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value