ncRNADetailInformation

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-106

MI0000406	MIPF0000001	AUGUCAAAGUGCUAACAGUGCAGGUAGCUUUUUGAGUUCUACUGCAGUGCCAGCACUUCUUACAU	MIMAT0000385 mmu-miR-106a-5p	CAAAGUGCUAACAGUGCAGGUAG	Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at twopositions but the precursor sequences are clearly closely related. Thesequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687).The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000406	MIPF0000001	AUGUCAAAGUGCUAACAGUGCAGGUAGCUUUUUGAGUUCUACUGCAGUGCCAGCACUUCUUACAU	MIMAT0017009 mmu-miR-106a-3p	ACUGCAGUGCCAGCACUUCUUAC	Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at twopositions but the precursor sequences are clearly closely related. Thesequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687).The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000407	MIPF0000001	CCUGCUGGGACUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCUGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGG	MIMAT0000386 mmu-miR-106b-5p	UAAAGUGCUGACAGUGCAGAU	Reference reported the same miRNA sequence with two differentidentifiers - miR-106b and miR-94.
	MIPF0001858		MIMAT000458

link to database

Interacted genes from RAID,miRTarBase

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0006357	regulation of transcription from RNA polymerase II promoter	Stat3,Hipk3,Mapk14,Bmp4,	2.82E-2
GO:0007423	sensory organ development	Stat3,Bcl2l11,Bmp4,	7.02E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value