ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-1

MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0031892 hsa-miR-1-5p	ACAUACUUCUUUAUAUGCCCAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .
MI0000651	MIPF0000038	UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA	MIMAT0000416 hsa-miR-1-3p	UGGAAUGUAAAGAAGUAUGUAU	Lagos-Quintana et al. reported the cloning of miR-1b, miR-1c andmiR-1d. The mature processed miR sequences are identical apart from the3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residuesof both miR-1b and miR-1c conflict with the predicted stem-loop precursorsequence shown here and these sequences are not found in currentassemblies of human and mouse genomes. It is suggested that polyApolymerase may add 1-3 nts to the 3' end of the mature transcript (TomTuschl, pers. comm.). The common 21 nts of the 3 reported miR sequenceshave been rationalised here and named miR-1. There are 2 pairs oforthologous putative hairpin precursor structures named mir-1-1 (humanMIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437,mouse MIR:MI0000652). The mature sequence shown here represents the mostcommonly cloned form from large-scale cloning studies .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

CDCP1,FBXO22,MRE11A,EHMT1,INTS6,MCM2,LCP1,MPRIP,MYO18A,CCL14,ACTA1,INPP5F,KLHDC5,HIF3A,C6orf97
more » CDCP1,FBXO22,MRE11A,EHMT1,INTS6,MCM2,LCP1,MPRIP,MYO18A,CCL14,ACTA1,INPP5F,KLHDC5,HIF3A,C6orf97,ITGA6,LNPEP,REM2,NSUN4,C12orf49,AMZ1,RBM42,IPO8,EHMT2,G3BP2,KIAA1598,CCDC102A,EXOC3,ABCB6,C12orf57,LMNB1,CNN3,MYLK3,RIPK2,SEPT6,VPS53,ZNF48,CORO1C,AXL,PRIMA1,SLC25A30,HSP90B1,SRSF6,SDC4,RBBP5,BAX,FAM102A,TRPM4,PDLIM7,PICALM,RAB11FIP2,SRSF9,HIST2H3C,GLI2,F11R,PSG3,PLS3,NUP210,CACNA1C,NOC2L,DBN1,CDK4,PRKAG1,FLNA,PSG6,C11orf31,TRIM9,EIF4G1,FUBP1,CENPF,DDX6,TBCD,PIM1,PIGS,PTPLB,KCND1,SNRNP35,ARID2,ATP6V1B2,BRPF3,GPD2,BCAP29,SNAI2,CLCN3,LRRC8B,KLK12,SYNE1,MOV10,MKI67IP,UNC45A,THAP2,H1FX,PLXNA4,PTPN1,EFCAB1,GATA4,DKK1,MYO1A,TRIM26,FBN1,PROCR,IMPDH1,SH3TC2,HIPK3,CACNA2D1,CCL2,GNB1,PSME1,EPB41L2,UBE2I,TRPS1,CD2AP,IGF1,TRA2B,C9orf174,H3F3B,PARVA,F2RL1,HNRNPA1,HEATR2,RRM1,B4GALT1,PSIP1,THBS1,LRRC8D,MSH2,OSTF1,MAST4,CSNK2A2,EML3,PACSIN3,RAP1B,ANGPTL4,PKD1L1,PLEKHH2,SOX5,NBL1,HNRNPA3,NAB1,TWF1,RBM12B,OSBPL7,DRAP1,UTRN,LRRC8A,ABHD11,SERP1,HSD3B7,ISG20,HDAC4,LHX4,CXCL1,HERC5,MCM7,MGC27345,ALDH2,KAT2A,ZC3H11A,CAPRIN1,MIA2,GPR137C,FADD,DDX50,FGFR2,DDX5,PAX3,LETM1,LRRC8C,MRPL19,LCA5L,CDC42,ASH2L,GPAA1,HNRNPU,ATP6V1E1,YTHDF2,C6orf118,GAK,LRWD1,POLRMT,FBXO45,LASP1,CALM3,XPNPEP3,ADAMTSL4,CCDC124,PRSS21,ETV7,POLR2I,DCUN1D1,YWHAZ,AFAP1,LZTFL1,IL27RA,HIST3H3,ARG1,DPP7,CAP1,EPB41L4B,GNG5,S100A16,ANPEP,SRF,ANP32E,PGM2,AP3D1,UGGT1,MXD4,CXCL2,KIF5B,BMP7,RRBP1,ANP32A,AP1S3,SP1,TPM2,CETN3,GIMAP4,C10orf137,NUP160,AP3B1,HYI,RBM28,TMSB4X,COL12A1,WDR11,ILVBL,LONP2,SOX9,RSF1,TMOD3,FMNL2,FADS1,CHAF1B,SRSF5,FRG1,MATR3,SAMD15,SEMA4D,LEMD3,PTAR1,CNOT6,ALG2,WDR33,ZNF207,IL11,BTC,ATP6V1A,ETNK1,HMOX1,CCND1,CDH13,CLEC1A,RAB27B,SCN3A,RPP40,C1orf27,MAD2L1,PTPLAD1,MCM3,TSPAN19,TMX1,RAPGEF2,EMP3,MTMR12,PTPMT1,NCAPD3,PXDN,AGMAT,SLC25A19,RSRC2,SNAPIN,MRFAP1,UNC93B1,DCAKD,BCAS4,TRIM2,AGRN,PI16,FLNC,ESYT1,ZNF622,TPSD1,ACTB,PLEKHG2,SUSD1,RCOR2,SLC27A4,GPR83,GTF2H1,NT5E,SUCLA2,PGD,PWP1,DTX1,CTBP1,ARCN1,MME,DPY19L1,KDM2B,HCN4,POLD1,CDK14,CAD,MAGEB3,HIGD1A,MYO3B,TAT,SOS2,GLTSCR2,YWHAQ,GSTO1,PTPN22,FOLR1,SLC26A7,C9orf46,COPG,CD63,ZNF561,HIST2H3D,CD44,CAMK2G,DYNC1LI1,ECHS1,ADAM12,FNDC3A,UBA6,TPD52L2,THY1,GOLGA7,NETO2,RBM39,FILIP1,FOXN4,SIN3A,IQCD,EXOC2,TMEM68,MKI67,KRT75,SFXN1,COPZ1,RBM47,PLK2,SLC39A3,HDAC2,DPY30,DROSHA,S100G,ANKRD17,PTPRD,NOTCH2,PRKCE,FBXO33,SLC16A9,UHRF1,MMD,SIGMAR1,ZNF568,GCH1,NT5C1B,MACROD1,ACADVL,S100A11,CAST,GNB2,ATP13A1,SLBP,HSPA4,KLHDC4,ANXA2,ZNF280C,POGK,IKBKAP,OXCT1,SGK3,SLC25A10,PRKG2,HNRNPD,FIG4,ITGA1,LEPREL2,EDN1,OSBPL10,SPERT,H3F3C,MPDU1,CLDN12,IL6,SMARCB1,SRI,CNIH4,UBTF,GATA6,NUP50,IST1,IL8,CLTC,PQBP1,ACTN4,ARHGAP29,FABP3,CHST11,FN1,AGTRAP,CXCL3,CTDNEP1,KCNN4,HP1BP3,LIN7C,ISG15,EGFR,CAND1,C6orf130,C2orf48,SMEK1,WASF2,GNPNAT1,USP33,MDC1,PARD6B,PPP2R1A,RAB34,CPSF3,MET,TMEM87A,BAG5,PHLDB2,VAMP7,TPM3,FAM167A,SFI1,IRF2BPL,GTF3C6,KCNJ2,PLXNB2,MFN2,PDE12,ATP6V1C1,ERMN,L1CAM,RABL2A,CTBP2,CEBPA,CPSF1,MECR,AP1M1,SDR39U1,ZNF638,ARF4,TPM1,G3BP1,PDCD4,NXT2,UNC119B,RHOC,ARMC10,AIM2,EFTUD2,SRGAP1,CCDC88C,RABEPK,HSD17B8,BCKDHB,MTX1,GCFC2,CBX5,CDH2,COPB1,LIMS1,ZNF579,SMARCA1,ACTN1,ATL3,SLC39A14,KIF2A,RAB30,UBAC2,GNRHR,IP6K2,RRP36,SRXN1,PDCD10,RAB39B,C4orf34,NXN,ABCB7,PPM1H,SSNA1,ATP2B4,FBLN2,HIST1H3B,FANCI,MCM4,SLC44A1,EIF4E,PLK1,FMNL3,DEFB125,PPARG,PSMG1,TNS4,ALG3,AHNAK2,FAM208A,DNAJB1,OCIAD2,MAP4K2,GNAT2,ORMDL2,SEMG2,TNKS1BP1,SYTL2,GJB3,NOTCH3,GPC1,HINT2,C1orf96,SHE,PSG9,SUGP1,PAFAH1B3,ABHD12,KLF4,AP1S1,HIST2H2AC,ANKFY1,CDC42SE1,NCAPG,FOXP1,SH2D4A,COQ6,CD109,ORC3,YTHDC1,ACP2,CSRP1,CRIP2,CHAMP1,FERMT2,SEC23IP,XPO6,HPS4,FRMD7,OAT,PPP2R1B,PIK3CA,ZBTB9,KLHL3,DDX60,RFC2,PLCXD2,GNAI1,NRP1,MRC2,JUP,POLR2K,C12orf10,CALR,EMD,ARPC5,CCND2,PIGT,NXPH2,CSTF3,CALM1,ARID1A,PTMAP7,KIF4A,MTHFD2,HOOK1,HS2ST1,BLCAP,FLNB,PLCB3,IGFBP7,RALB,ARF3,FLOT2,PREX1,EDF1,EML4,AKR1D1,SMARCC1,G6PD,FTSJ1,TKT,ARGLU1,PPIA,CA3,TBC1D9,MSH6,B3GNT2,PSAT1,PYGB,TIMP3,PLXDC2,POLA2,UGT8,DFNA5,COMMD2,CTTN,CERS2,SREK1,RASSF5,COTL1,C12orf40,IFIT2,PTMA,HIST1H1B,OXTR,CAPN1,ZNF384,SDPR,BRI3BP,CHSY1,HNRNPH1,FAM81A,SRSF7,NPTN,PRDX2,TRAPPC3,TUBB2B,HIST2H3A,CHMP2A,TSPAN4,E2F5,CBR4,CBX2,ABCB5,GJA1,SH3BGRL3,CEBPZ,TMCC1,NAT14,PGRMC2,RASSF1,GPX1P1,KANK2,HSPD1,MIER1,MTHFS,RFC5,MMS22L,TRIM24,SNX6,PCDH7,CALM2,RABGAP1L,PPP1R16A,SRSF4,MOBP,TSHR,SMARCA2,WLS,LRP1,AKAP12,HSD17B11,KIAA1522,STXBP3,GNPDA2,RABL2B,DDX42,HERC2,NUAK1,WDFY1,MCM5,ZNF326,ANP32B,BDNF,PNP,MAN1B1,PLS1,CCDC134,PTPRF,CDK9,MYO1B,ANKIB1,SYNE2,LGALS1,ATP6V0A1,ACPL2,DDTL,SEC61A1,GNA13,COIL,CDH4,ZNF264,PDIA3,POM121,RCC2,CTSC,SOX6,MOB4,KIAA1731,AKAP4,IFI44,CUL4B,FHDC1,UGGT2,SEC16A,SSR1,PIR,TLR4,F2,ABCC4,PPAP2C,CHRAC1,DOLPP1,TIGD4,RPRD2,MCM6,HNRNPA1L2,KNCN,FNDC3B,VASP,VMP1,MYOCD,ABCC1,GCFC1,IFIT3,ANKRD29,SFN,PPP2R2A,CRELD2,EFR3A,MINPP1,CPOX,CYP20A1,HCN2,DNAJC10,RXFP1,ZBTB6,LEPREL4,AP2S1,UNC13D,SRRM1,FUBP3,SH3PXD2B,RIN1,IFT52,TPM4,SPINK1,LIPC,NR5A2,ITGB4,SYNPO2L,GATA3,ELMOD2,UBR5,NCS1,STK24,RNF213,GNAI3,SLC8A1,AGPAT6,CDC42BPB,IPO9,PPIB,FAM57A,APEH,NDUFS4,ITGA3,GNAI2,RIMS2,SCAF11,SEC11C,DGKH,CRYGS,ADPGK,AP1B1,AIFM2,ADAR,MARCKS,IFIT1,PTBP1,EPB49,PNN,XPOT,PPP2R5A,PPA2,TROVE2,MON2,SLC35A5,LGALS3BP,DCTPP1,RGS17,TTC37,TAGLN2,SPRY2,PACS2,SMC4,OASL,HADH,RNF138,SERPINB5,ZNF799,TRPM6,KIF2C,SLC29A1,RGN,CAPG,TDP1,KCNE1,SLC25A22,DHX15,GJA1P1,LARP4,C1orf56,UST,MEF2A,DDT,MCAM,KDELR1,ARHGEF18,CCDC22,AMDHD1,DHRS1,TMEM106C,BCL6B,HAND2,TWF2,PLEKHB2,BRDT,PTBP2,TRPA1,GOLPH3,DOK6,RFT1,LIFR,TH1L,ACTC1,SEC62,MFSD10,SAC3D1,DSG2,IQGAP3,TTC17,SLC25A1,TELO2,SYPL1,C1orf173,SYMPK,POM121C,PFDN1,SPC24

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05410	Hypertrophic cardiomyopathy (HCM)	CACNA2D1,ITGA1,SLC8A1,CACNA1C,IGF1,ITGB4,ITGA3,TPM2,TPM1,PRKAG1,ACTC1,TPM4,EMD,ACTB,IL6,ITGA6,TPM3,	2.43E-5
hsa05412	Arrhythmogenic right ventricular cardiomyopathy (ARVC)	CACNA2D1,ITGA1,SLC8A1,CACNA1C,ITGB4,JUP,GJA1,ITGA3,EMD,ACTN4,ACTB,DSG2,ACTN1,ITGA6,CDH2,	1.01E-4
hsa03030	DNA replication	MCM4,MCM3,MCM6,MCM5,POLA2,MCM7,POLD1,RFC5,RFC2,MCM2,	1.62E-4
hsa04530	Tight junction	CTTN,CSNK2A2,CDK4,GNAI3,PPP2R2A,PARD6B,GNAI1,GNAI2,PPP2R1A,PPP2R1B,EPB41L2,ACTN4,EXOC3,ACTB,ACTN1,SYMPK,CDC42,F11R,PRKCE,	7.01E-4
hsa05414	Dilated cardiomyopathy	CACNA2D1,ITGA1,SLC8A1,CACNA1C,IGF1,ITGB4,ITGA3,TPM2,TPM1,ACTC1,TPM4,EMD,ACTB,ITGA6,TPM3,	7.93E-4

hsa04510	Focal adhesion	CCND1,SOS2,ITGA1,RAP1B,EGFR,FLNC,PARVA,FLNA,FN1,FLNB,IGF1,ITGB4,VASP,PIK3CA,ITGA3,CCND2,MYLK3,ACTN4,ACTB,ACTN1,MET,ITGA6,CDC42,THBS1,	1.32E-2
hsa04110	Cell cycle	CCND1,MCM4,YWHAQ,MCM3,MCM6,SFN,MCM5,MCM7,CDK4,E2F5,MCM2,PLK1,YWHAZ,CCND2,HDAC2,MAD2L1,ORC3,	2.29E-2
hsa05120	Epithelial cell signaling in Helicobacter pylori infection	ATP6V1A,ATP6V0A1,CXCL1,EGFR,ATP6V1E1,ATP6V1B2,MET,CDC42,ATP6V1C1,F11R,IL8,	5.62E-2
hsa04320	Dorso-ventral axis formation	SOS2,NOTCH3,NOTCH2,EGFR,ETV7,HSD3B7,	1.32E-1
hsa04520	Adherens junction	WASF2,CSNK2A2,EGFR,PTPRF,PTPN1,ACTN4,SNAI2,ACTB,MET,ACTN1,CDC42,	1.33E-1
hsa03040	Spliceosome	SRSF6,SRSF7,TRA2B,EFTUD2,SRSF5,HNRNPA1L2,SRSF9,PQBP1,DHX15,HNRNPA1,HNRNPA3,DDX5,SRSF4,HNRNPU,DDX42,	1.44E-1
hsa05200	Pathways in cancer	SOS2,EGFR,FN1,IGF1,JUP,RASSF5,CEBPA,ITGA3,FADD,MSH6,ITGA6,HSP90B1,MET,IL8,CCND1,CTBP2,CTBP1,RALB,BAX,FGFR2,MSH2,CDK4,RASSF1,PPARG,GLI2,PIK3CA,HDAC2,IL6,CDC42,TPM3,	1.50E-1
hsa04670	Leukocyte transendothelial migration	RAP1B,VASP,GNAI3,RASSF5,GNAI1,PIK3CA,GNAI2,THY1,ACTN4,ACTB,ACTN1,CDC42,F11R,	4.15E-1
hsa03430	Mismatch repair	POLD1,RFC5,MSH2,MSH6,RFC2,	4.18E-1
hsa05110	Vibrio cholerae infection	KDELR1,ATP6V1A,ATP6V0A1,ATP6V1E1,ATP6V1B2,ACTB,SEC61A1,ATP6V1C1,	4.28E-1
hsa04062	Chemokine signaling pathway	SOS2,RAP1B,CXCL1,PLCB3,CCL14,GNG5,CXCL2,CCL2,CXCL3,GNAI3,GNB2,PREX1,GNAI1,PIK3CA,GNAI2,GNB1,CDC42,IL8,	4.46E-1
hsa04810	Regulation of actin cytoskeleton	WASF2,SOS2,F2,ITGA1,TMSB4X,EGFR,IQGAP3,FGFR2,FN1,GNA13,ITGB4,PIK3CA,ARPC5,ITGA3,MYLK3,ACTN4,ACTB,ACTN1,ITGA6,CDC42,	4.47E-1
hsa04730	Long-term depression	GNAI1,GNAI2,PLCB3,PPP2R1A,GNA13,PPP2R1B,IGF1,GNAI3,PRKG2,	4.63E-1
hsa05130	Pathogenic Escherichia coli infection	CTTN,YWHAQ,ARPC5,TLR4,TUBB2B,YWHAZ,ACTB,CDC42,	4.65E-1
hsa04330	Notch signaling pathway	CTBP2,CTBP1,NOTCH3,NOTCH2,DTX1,HDAC2,KAT2A,	5.39E-1
hsa05214	Glioma	CCND1,PIK3CA,SOS2,CALM2,EGFR,CALM1,CAMK2G,CALM3,CDK4,IGF1,	7.26E-1
hsa00062	Fatty acid elongation in mitochondria	HADH,ECHS1,MECR,	7.53E-1
hsa05223	Non-small cell lung cancer	CCND1,PIK3CA,SOS2,EGFR,CDK4,RASSF1,RASSF5,	9.28E-1
hsa05219	Bladder cancer	CCND1,EGFR,CDK4,RASSF1,THBS1,IL8,	9.56E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0008104	protein localization	F2,RAB34,SERP1,COPB1,VPS53,HERC2,NUP160,MFN2,SNAPIN,SEC23IP,RIMS2,SNX6,ACTN4,AP1S3,AKAP12,XPO6,NUP210,SEC16A,HPS4,AP3B1,POLA2,NXT2,BAX,RAB11FIP2,GPAA1,ARCN1,POM121C,ALG2,HOOK1,AP1B1,ARF4,TNS4,LIN7C,ARF3,RAB27B,EXOC3,IPO9,NUP50,LONP2,YWHAQ,IPO8,G3BP2,COPZ1,TRPS1,EGFR,FLNA,FLNB,AP3D1,VAMP7,POM121,RRBP1,RAB30,KDELR1,MTX1,AP1M1,AP2S1,SSR1,HSP90B1,BCAP29,AP1S1,CALR,EXOC2,AKAP4,PDIA3,MON2,STXBP3,TMSB4X,CHMP2A,CENPF,PPARG,COPG,SYTL2,CLTC,YWHAZ,SEC62,RAB39B,SEC61A1,CDC42,	4.29E-7
GO:0030036	actin cytoskeleton organization	FMNL3,ACTA1,CXCL1,PARVA,FLNA,FLNB,FERMT2,CDC42BPB,PREX1,PDLIM7,TPM1,DBN1,FMNL2,CAP1,ACTN4,ACTN1,CNN3,FHDC1,CALR,WASF2,ERMN,TMSB4X,VASP,PLS3,LCP1,ARPC5,EPB41L2,ACTC1,CDC42,EPB49,	1.95E-6
GO:0045184	establishment of protein localization	F2,RAB34,SERP1,COPB1,VPS53,HERC2,NUP160,MFN2,SNAPIN,SEC23IP,RIMS2,SNX6,AP1S3,ACTN4,AKAP12,XPO6,NUP210,SEC16A,HPS4,POLA2,AP3B1,NXT2,RAB11FIP2,ARCN1,POM121C,HOOK1,AP1B1,ARF4,LIN7C,ARF3,RAB27B,EXOC3,IPO9,NUP50,LONP2,YWHAQ,IPO8,COPZ1,TRPS1,FLNA,AP3D1,VAMP7,POM121,RRBP1,RAB30,KDELR1,MTX1,AP1M1,AP2S1,SSR1,HSP90B1,BCAP29,AP1S1,CALR,EXOC2,PDIA3,MON2,STXBP3,CHMP2A,CENPF,PPARG,COPG,SYTL2,CLTC,YWHAZ,SEC62,RAB39B,SEC61A1,	2.76E-6
GO:0008380	RNA splicing	EFTUD2,CSTF3,POLR2I,SREK1,HNRNPA1L2,ZNF638,CPSF3,FRG1,DHX15,HNRNPA1,PPP2R1A,HNRNPA3,POLR2K,HNRNPU,RBM28,SCAF11,CPSF1,SRSF6,SRSF7,TRA2B,PNN,SRSF5,YTHDC1,SRSF9,PTBP1,SUGP1,HNRNPH1,RBM39,HNRNPD,DDX5,SRSF4,ABCB5,SRRM1,SNRNP35,PTBP2,	3.62E-6
GO:0015031	protein transport	F2,RAB34,SERP1,COPB1,VPS53,HERC2,NUP160,MFN2,SNAPIN,SEC23IP,RIMS2,SNX6,AP1S3,ACTN4,AKAP12,XPO6,NUP210,SEC16A,HPS4,POLA2,AP3B1,NXT2,RAB11FIP2,ARCN1,POM121C,HOOK1,AP1B1,ARF4,LIN7C,ARF3,RAB27B,EXOC3,IPO9,NUP50,LONP2,YWHAQ,IPO8,COPZ1,TRPS1,AP3D1,VAMP7,POM121,RRBP1,RAB30,KDELR1,MTX1,AP1M1,AP2S1,SSR1,HSP90B1,BCAP29,AP1S1,CALR,EXOC2,PDIA3,MON2,STXBP3,CHMP2A,CENPF,PPARG,COPG,SYTL2,CLTC,YWHAZ,SEC62,RAB39B,SEC61A1,	3.95E-6

GO:0046907	intracellular transport	F2,ATL3,COPB1,KIF4A,HERC2,MFN2,ANP32A,NUP160,SEC23IP,SNAPIN,TPM1,RIMS2,SNX6,AP1S3,AKAP12,XPO6,WASF2,HPS4,POLA2,AP3B1,BAX,ARCN1,HOOK1,AP1B1,ACTC1,IPO9,NUP50,SLC25A30,LONP2,YWHAQ,IPO8,COPZ1,TRPS1,FLNA,AP3D1,VAMP7,KDELR1,HNRNPA1,MTX1,AP1M1,AP2S1,SSR1,KIF5B,AP1S1,BCAP29,CALR,SLC25A10,PDIA3,MON2,TRAPPC3,COPG,TMX1,ZNF384,SYTL2,CLTC,YWHAZ,SEC62,SEC61A1,XPOT,SLC25A1,	4.47E-6
GO:0043933	macromolecular complex subunit organization	GCH1,ATL3,POLR2I,PARVA,HIST1H1B,JUP,PREX1,FADD,POLR2K,RSF1,CBR4,H1FX,DGKH,XPO6,HIST2H3C,AGRN,BAX,GPAA1,PSMG1,HSPA4,SRSF9,KIF2C,ANGPTL4,CD2AP,CHAF1B,HIST3H3,HIST1H3B,HIST2H3A,IPO9,CDH2,H3F3C,CAPG,IPO8,HIST2H2AC,CCDC88C,IKBKAP,TUBB2B,FLNA,RRM1,CDK9,PARD6B,LIPC,PICALM,GJA1,PPP2R1A,MKI67IP,ARID1A,SCAF11,AP2S1,SRSF6,CALR,STXBP3,SRSF5,NDUFS4,CENPF,MCM2,DCTPP1,HSPD1,GTF2H1,H3F3B,NAT14,PRKAG1,TRIM24,HIST2H3D,TSPAN4,HP1BP3,	6.01E-6
GO:0065003	macromolecular complex assembly	GCH1,ATL3,POLR2I,PARVA,HIST1H1B,JUP,PREX1,FADD,POLR2K,RSF1,CBR4,H1FX,DGKH,XPO6,HIST2H3C,AGRN,BAX,GPAA1,PSMG1,HSPA4,SRSF9,ANGPTL4,CD2AP,CHAF1B,HIST3H3,HIST1H3B,HIST2H3A,IPO9,CDH2,H3F3C,CAPG,IPO8,HIST2H2AC,CCDC88C,IKBKAP,TUBB2B,FLNA,RRM1,CDK9,PARD6B,PICALM,GJA1,PPP2R1A,MKI67IP,SCAF11,AP2S1,SRSF6,CALR,STXBP3,SRSF5,NDUFS4,CENPF,MCM2,DCTPP1,HSPD1,GTF2H1,H3F3B,NAT14,PRKAG1,TRIM24,HIST2H3D,TSPAN4,HP1BP3,	6.37E-6
GO:0030029	actin filament-based process	FMNL3,ACTA1,CXCL1,PARVA,FLNA,FLNB,FERMT2,CDC42BPB,PREX1,PDLIM7,TPM1,DBN1,FMNL2,CAP1,ACTN4,ACTN1,CNN3,FHDC1,CALR,WASF2,ERMN,TMSB4X,VASP,PLS3,LCP1,ARPC5,EPB41L2,ACTC1,CDC42,EPB49,	7.10E-6
GO:0034613	cellular protein localization	YWHAQ,LONP2,IPO8,F2,COPZ1,TRPS1,EGFR,FLNA,COPB1,AP3D1,HERC2,MFN2,SNAPIN,SEC23IP,KDELR1,RIMS2,MTX1,SNX6,AP1M1,AP1S3,AP2S1,AKAP12,SSR1,AP1S1,BCAP29,XPO6,CALR,HPS4,PDIA3,AP3B1,POLA2,BAX,ARCN1,COPG,AP1B1,SYTL2,CLTC,YWHAZ,SEC62,SEC61A1,CDC42,IPO9,	1.19E-5
GO:0070727	cellular macromolecule localization	YWHAQ,LONP2,IPO8,F2,COPZ1,TRPS1,EGFR,FLNA,COPB1,AP3D1,HERC2,MFN2,SNAPIN,SEC23IP,KDELR1,RIMS2,MTX1,SNX6,AP1M1,AP1S3,AP2S1,AKAP12,SSR1,AP1S1,BCAP29,XPO6,CALR,HPS4,PDIA3,AP3B1,POLA2,BAX,ARCN1,COPG,AP1B1,SYTL2,CLTC,YWHAZ,SEC62,SEC61A1,CDC42,IPO9,	1.41E-5
GO:0000375	RNA splicing, via transesterification reactions	SRSF6,SRSF7,TRA2B,EFTUD2,CSTF3,POLR2I,SRSF5,YTHDC1,SRSF9,CPSF3,PTBP1,SUGP1,HNRNPH1,HNRNPA1,HNRNPD,HNRNPA3,SRSF4,POLR2K,HNRNPU,SRRM1,SCAF11,CPSF1,	1.80E-5
GO:0000377	RNA splicing, via transesterification reactions with bulged adenosine as nucleophile	SRSF6,SRSF7,TRA2B,EFTUD2,CSTF3,POLR2I,SRSF5,YTHDC1,SRSF9,CPSF3,PTBP1,SUGP1,HNRNPH1,HNRNPA1,HNRNPD,HNRNPA3,SRSF4,POLR2K,HNRNPU,SRRM1,SCAF11,CPSF1,	1.80E-5
GO:0000398	nuclear mRNA splicing, via spliceosome	SRSF6,SRSF7,TRA2B,EFTUD2,CSTF3,POLR2I,SRSF5,YTHDC1,SRSF9,CPSF3,PTBP1,SUGP1,HNRNPH1,HNRNPA1,HNRNPD,HNRNPA3,SRSF4,POLR2K,HNRNPU,SRRM1,SCAF11,CPSF1,	1.80E-5
GO:0006397	mRNA processing	EFTUD2,CSTF3,POLR2I,SREK1,HNRNPA1L2,CPSF3,FRG1,DHX15,HNRNPA1,HNRNPA3,POLR2K,HNRNPU,RBM28,SCAF11,ADAR,CPSF1,SRSF6,SRSF7,TRA2B,MOV10,PNN,SRSF5,YTHDC1,SRSF9,PTBP1,SUGP1,HNRNPH1,SLBP,RBM39,HNRNPD,DDX5,SRSF4,ABCB5,SRRM1,SNRNP35,PTBP2,	1.93E-5
GO:0016044	membrane organization	RABEPK,CTDNEP1,COPZ1,EGFR,RAB34,KCNN4,CDC42SE1,SERP1,COPB1,VAMP7,MFN2,MRC2,PDLIM7,PICALM,CAP1,AP1M1,EMD,AP1S3,AP2S1,AP1S1,FOLR1,WASF2,RIN1,PACSIN3,AP3B1,AGRN,LRP1,BAX,ARCN1,GNAI3,HSPA4,COPG,LETM1,AP1B1,ELMOD2,CLTC,UNC13D,CORO1C,THBS1,	2.48E-5
GO:0070271	protein complex biogenesis	CAPG,IPO8,GCH1,ATL3,IKBKAP,CCDC88C,POLR2I,TUBB2B,PARVA,FLNA,RRM1,JUP,CDK9,PREX1,PARD6B,GJA1,PICALM,FADD,PPP2R1A,MKI67IP,POLR2K,RSF1,CBR4,AP2S1,DGKH,XPO6,CALR,AGRN,STXBP3,BAX,NDUFS4,GPAA1,CENPF,PSMG1,HSPA4,DCTPP1,HSPD1,GTF2H1,NAT14,PRKAG1,TRIM24,ANGPTL4,CD2AP,TSPAN4,CHAF1B,IPO9,CDH2,	3.66E-5
GO:0006461	protein complex assembly	CAPG,IPO8,GCH1,ATL3,IKBKAP,CCDC88C,POLR2I,TUBB2B,PARVA,FLNA,RRM1,JUP,CDK9,PREX1,PARD6B,GJA1,PICALM,FADD,PPP2R1A,MKI67IP,POLR2K,RSF1,CBR4,AP2S1,DGKH,XPO6,CALR,AGRN,STXBP3,BAX,NDUFS4,GPAA1,CENPF,PSMG1,HSPA4,DCTPP1,HSPD1,GTF2H1,NAT14,PRKAG1,TRIM24,ANGPTL4,CD2AP,TSPAN4,CHAF1B,IPO9,CDH2,	3.66E-5
GO:0006886	intracellular protein transport	YWHAQ,LONP2,IPO8,F2,COPZ1,TRPS1,COPB1,AP3D1,HERC2,MFN2,SEC23IP,SNAPIN,KDELR1,RIMS2,MTX1,SNX6,AP1M1,AP1S3,AP2S1,AKAP12,SSR1,AP1S1,BCAP29,XPO6,CALR,HPS4,PDIA3,AP3B1,POLA2,ARCN1,COPG,AP1B1,SYTL2,CLTC,YWHAZ,SEC62,SEC61A1,IPO9,	3.78E-5
GO:0016192	vesicle-mediated transport	RABEPK,ATL3,RAB34,COPB1,SNAPIN,CAP1,AP1S3,WASF2,SEC16A,RIN1,AP3B1,CACNA1C,LRP1,ARCN1,HOOK1,ARF4,AP1B1,LIN7C,ARF3,UNC13D,EXOC3,CORO1C,MAP4K2,COPZ1,CDC42SE1,FLNA,AP3D1,VAMP7,MRC2,PDLIM7,PICALM,KDELR1,AP1M1,AP2S1,AP1S1,BCAP29,FOLR1,EXOC2,PACSIN3,MON2,STXBP3,TRAPPC3,GNAI3,COPG,ELMOD2,TMX1,SYTL2,CLTC,YWHAZ,THBS1,	1.15E-4
GO:0060284	regulation of cell development	CALR,CDH4,NOTCH3,AGRN,NPTN,PTPRF,BAX,B4GALT1,PLXNB2,HDAC4,SEMA4D,GLI2,BMP7,PPARG,EDN1,THY1,DBN1,NRP1,DTX1,MYOCD,BDNF,CCND2,SOX5,CDH2,	1.80E-4
GO:0043193	positive regulation of gene-specific transcription	SMARCA2,SMARCA1,SRF,SMARCB1,HDAC4,IGF1,GATA6,GATA4,PPARG,CEBPA,NR5A2,MYOCD,HDAC2,IL6,	3.00E-4
GO:0016071	mRNA metabolic process	EFTUD2,CSTF3,POLR2I,SREK1,HNRNPA1L2,CPSF3,FRG1,DHX15,HNRNPA1,HNRNPA3,POLR2K,HNRNPU,RBM28,SCAF11,ADAR,CPSF1,SRSF6,SRSF7,TRA2B,MOV10,PNN,SRSF5,YTHDC1,SRSF9,PTBP1,SUGP1,HNRNPH1,SLBP,RBM39,HNRNPD,DDX5,SRSF4,ABCB5,SRRM1,SNRNP35,PTBP2,	3.18E-4
GO:0006338	chromatin remodeling	SMARCA2,SMARCA1,BRDT,SMARCC1,SMARCB1,HDAC4,ARID1A,HDAC2,RSF1,CHRAC1,KAT2A,	3.43E-4
GO:0042127	regulation of cell proliferation	SMARCA2,SFN,NOTCH2,CXCL1,BTC,RIPK2,B4GALT1,IGF1,CCL2,MFN2,TSHR,CEBPA,TPD52L2,PNP,SOX9,IL8,CTBP2,CTBP1,PAX3,EMP3,PTPRF,BAX,FGFR2,CCL14,EDN1,IGFBP7,NRP1,KLF4,IL11,CAPN1,EGFR,FOXP1,GATA4,S100A11,GJA1,GNAI2,BDNF,FABP3,SSR1,CCND1,CALR,NDUFS4,HDAC4,CDK4,CHST11,GNRHR,PPARG,BMP7,GLI2,CDH13,CRIP2,HMOX1,TRIM24,MXD4,NR5A2,LIFR,MYOCD,CCND2,HDAC2,IL6,THBS1,	4.01E-4
GO:0006901	vesicle coating	PICALM,COPZ1,COPB1,ARCN1,AP2S1,COPG,	5.54E-4
GO:0006900	membrane budding	PICALM,COPZ1,COPB1,ARCN1,AP2S1,COPG,	7.74E-4
GO:0006270	DNA replication initiation	MCM4,MCM3,MCM6,MCM5,MCM7,MCM2,	7.74E-4
GO:0034622	cellular macromolecular complex assembly	H3F3C,IPO8,HIST2H2AC,TUBB2B,FLNA,HIST1H1B,PREX1,PICALM,SCAF11,RSF1,H1FX,AP2S1,CALR,SRSF6,XPO6,HIST2H3C,AGRN,SRSF5,NDUFS4,CENPF,PSMG1,HSPA4,MCM2,SRSF9,HSPD1,H3F3B,HIST2H3D,HIST3H3,CHAF1B,HIST1H3B,IPO9,HIST2H3A,HP1BP3,	9.70E-4
GO:0051960	regulation of nervous system development	CALR,CDH4,NOTCH3,AGRN,NPTN,PTPRF,OXTR,PLXNB2,SEMA4D,IGF1,GLI2,BMP7,PPARG,THY1,DBN1,NRP1,DTX1,BDNF,CCND2,SOX5,CDH2,	1.19E-2
GO:0034621	cellular macromolecular complex subunit organization	H3F3C,IPO8,HIST2H2AC,TUBB2B,FLNA,HIST1H1B,PREX1,PICALM,ARID1A,RSF1,SCAF11,AP2S1,H1FX,CALR,SRSF6,XPO6,HIST2H3C,AGRN,SRSF5,NDUFS4,CENPF,PSMG1,HSPA4,MCM2,SRSF9,HSPD1,H3F3B,KIF2C,HIST2H3D,HIST3H3,CHAF1B,HIST1H3B,IPO9,HIST2H3A,HP1BP3,	1.46E-2
GO:0051276	chromosome organization	SMARCA2,H3F3C,SMARCA1,SMARCC1,HIST2H2AC,NCAPG,SMARCB1,CBX2,CHRAC1,HIST1H1B,LEPREL4,EHMT2,KAT2A,CBX5,KDM2B,MSH6,ARID1A,RSF1,H1FX,ARID2,AIFM2,BRDT,MRE11A,HIST2H3C,MSH2,HDAC4,CENPF,MCM2,BRPF3,EHMT1,H3F3B,TNKS1BP1,SOX6,HIST2H3D,NCAPD3,HDAC2,HIST3H3,CHAF1B,HIST1H3B,MAD2L1,HIST2H3A,SMC4,HP1BP3,	1.63E-2
GO:0006323	DNA packaging	H3F3C,HIST2H3C,HIST2H2AC,NCAPG,HIST1H1B,MCM2,H3F3B,HIST2H3D,NCAPD3,RSF1,HIST3H3,H1FX,CHAF1B,HIST1H3B,HIST2H3A,AIFM2,SMC4,HP1BP3,	1.73E-2
GO:0001775	cell activation	F2,EGFR,PRDX2,RIPK2,GNA13,VAMP7,FOXP1,PREX1,TSHR,PTPN22,MSH6,IL8,LRRC8A,STXBP3,BAX,MSH2,HDAC4,IMPDH1,EDN1,HSPD1,LCP1,TMX1,TLR4,YWHAZ,UNC13D,IL6,IL11,	1.90E-2
GO:0007264	small GTPase mediated signal transduction	YWHAQ,SOS2,G3BP2,PTPLAD1,RAB34,IQGAP3,GNA13,IGF1,ARHGAP29,RAB30,RHOC,REM2,RABL2A,RABL2B,RAPGEF2,WASF2,RALB,RAP1B,RASSF1,CDH13,ARF4,HMOX1,GNB1,ARF3,RAB27B,G3BP1,RAB39B,CDC42,	2.19E-2
GO:0014070	response to organic cyclic substance	CCND1,LONP2,MSH2,OXTR,ALDH2,CD44,PPARG,FADS1,PPP2R2A,TAT,HMOX1,IGFBP7,HDAC2,CCND2,TIMP3,	2.38E-2
GO:0060627	regulation of vesicle-mediated transport	CALR,PACSIN3,CD63,STXBP3,B4GALT1,CDH13,HMOX1,NCS1,RAB27B,CD2AP,UNC13D,ACTN4,AP2S1,	2.49E-2
GO:0051094	positive regulation of developmental process	SRF,CDH4,NPTN,BTC,OXTR,PLXNB2,B4GALT1,SEMA4D,GATA6,AP3D1,GATA4,FNDC3B,SH3PXD2B,PDLIM7,PNP,BDNF,HPS4,AP3B1,PTPRF,BAX,GLI2,BMP7,PPARG,ANGPTL4,IL6,THBS1,	2.52E-2
GO:0007015	actin filament organization	PLS3,LCP1,ERMN,DBN1,ACTA1,FLNA,ACTC1,ACTN4,ACTN1,PREX1,EPB49,	2.56E-2
GO:0007010	cytoskeleton organization	FMNL3,ACTA1,CXCL1,PARVA,FLNA,FLNB,FERMT2,CDC42BPB,CETN3,PREX1,PDLIM7,DBN1,TPM1,LASP1,FMNL2,CAP1,ACTN4,ACTN1,CNN3,FHDC1,CALR,WASF2,ERMN,TMSB4X,HOOK1,VASP,PLS3,LCP1,ARPC5,THY1,KIF2C,SAC3D1,EPB41L2,ACTC1,CDC42,EPB49,	2.84E-2
GO:0050767	regulation of neurogenesis	CALR,CDH4,NOTCH3,NPTN,PTPRF,PLXNB2,SEMA4D,GLI2,PPARG,BMP7,THY1,DBN1,NRP1,DTX1,BDNF,CCND2,SOX5,CDH2,	3.22E-2
GO:0006928	cell motion	SRF,CDH4,B3GNT2,B4GALT1,GNA13,FN1,IGF1,CCL2,CD44,L1CAM,TPM1,CAP1,BDNF,ACTB,MET,SERPINB5,ITGA6,IL8,WASF2,PAX3,ITGA1,AKAP4,BAX,MSH2,CXCL3,VASP,BMP7,GLI2,CDH13,ARPC5,LHX4,NRP1,TPM4,CD2AP,IL6,TPM3,THBS1,CDH2,	3.66E-2
GO:0035239	tube morphogenesis	SRF,PAX3,SPRY2,B4GALT1,GNA13,IGF1,GATA4,VASP,CD44,BMP7,GLI2,EDN1,IFT52,NRP1,HAND2,	3.72E-2
GO:0051235	maintenance of location	CALR,SRI,KDELR1,PDIA3,G3BP2,TMSB4X,FLNA,GPAA1,FLNB,HSP90B1,	3.80E-2
GO:0045321	leukocyte activation	LRRC8A,STXBP3,PRDX2,BAX,MSH2,RIPK2,HDAC4,FOXP1,VAMP7,PREX1,IMPDH1,EDN1,HSPD1,TSHR,LCP1,TMX1,TLR4,PTPN22,YWHAZ,MSH6,UNC13D,IL11,IL8,	3.93E-2
GO:0006396	RNA processing	EFTUD2,CSTF3,INTS6,POLR2I,DROSHA,SREK1,ZNF638,HNRNPA1L2,RPP40,CPSF3,FRG1,DHX15,HNRNPA1,PPP2R1A,HNRNPA3,POLR2K,HNRNPU,RBM28,ADAR,SCAF11,CPSF1,SRSF6,SRSF7,TRA2B,MOV10,PNN,SRSF5,YTHDC1,SRSF9,PTBP1,HSD3B7,SUGP1,HNRNPH1,SLBP,RBM39,HNRNPD,DDX5,FTSJ1,SRSF4,ABCB5,SRRM1,SNRNP35,PTBP2,	4.51E-2
GO:0065004	protein-DNA complex assembly	H3F3C,HIST2H3C,HIST2H2AC,CENPF,HIST1H1B,MCM2,H3F3B,HIST2H3D,RSF1,CHAF1B,HIST3H3,H1FX,HIST1H3B,HIST2H3A,HP1BP3,	4.81E-2
GO:0001932	regulation of protein amino acid phosphorylation	CCND1,F2,CCDC88C,EGFR,PTPLAD1,BAX,NDUFS4,IGF1,BMP7,PDCD4,EDN1,TLR4,PPP2R1A,CCND2,HIPK3,IL6,IL11,PRKCE,	4.92E-2
GO:0045737	positive regulation of cyclin-dependent protein kinase activity	CCND1,PIM1,EGFR,CCND2,	5.45E-2
GO:0045664	regulation of neuron differentiation	CALR,CDH4,NOTCH3,PTPRF,PLXNB2,SEMA4D,GLI2,THY1,DBN1,NRP1,DTX1,BDNF,CCND2,SOX5,CDH2,	5.63E-2
GO:0034728	nucleosome organization	H3F3C,HIST2H3C,HIST2H2AC,HIST1H1B,MCM2,H3F3B,HIST2H3D,ARID1A,RSF1,CHAF1B,HIST3H3,H1FX,HIST1H3B,HIST2H3A,HP1BP3,	5.68E-2
GO:0010324	membrane invagination	FOLR1,RABEPK,WASF2,RIN1,AP3B1,PACSIN3,LRP1,RAB34,CDC42SE1,VAMP7,MRC2,PDLIM7,PICALM,AP1B1,ELMOD2,CAP1,UNC13D,AP1S3,CORO1C,THBS1,AP1S1,	5.81E-2
GO:0006897	endocytosis	FOLR1,RABEPK,WASF2,RIN1,AP3B1,PACSIN3,LRP1,RAB34,CDC42SE1,VAMP7,MRC2,PDLIM7,PICALM,AP1B1,ELMOD2,CAP1,UNC13D,AP1S3,CORO1C,THBS1,AP1S1,	5.81E-2
GO:0010552	positive regulation of specific transcription from RNA polymerase II promoter	CEBPA,SMARCA2,SRF,SMARCB1,MYOCD,HDAC4,HDAC2,GATA6,PPARG,	6.29E-2
GO:0007517	muscle organ development	SRI,PAX3,TAGLN2,ACTA1,AGRN,MEF2A,SERP1,FLNB,GATA6,IGF1,CENPF,FOXP1,HIST1H1B,UNC45A,UTRN,TPM1,SOX6,ACTC1,EMD,MET,	7.80E-2
GO:0006334	nucleosome assembly	H3F3C,HIST2H3C,HIST2H2AC,HIST1H1B,MCM2,H3F3B,HIST2H3D,RSF1,CHAF1B,HIST3H3,H1FX,HIST1H3B,HIST2H3A,HP1BP3,	7.82E-2
GO:0042119	neutrophil activation	STXBP3,VAMP7,PREX1,IL8,	7.88E-2
GO:0042325	regulation of phosphorylation	SFN,F2,CCDC88C,EGFR,PRDX2,PTPLAD1,IGF1,HERC5,PDCD4,GNAI2,PPP2R1A,SNX6,MET,HIPK3,DGKH,PRKCE,CCND1,ITGA1,SPRY2,MCM7,BAX,LRP1,NDUFS4,BMP7,EDN1,GTF2H1,PIM1,PRKAG1,THY1,TLR4,SDC4,CCND2,IL6,CDC42,THBS1,IL11,	8.15E-2
GO:0003012	muscle system process	ACTA1,SLC8A1,CACNA1C,OXTR,HDAC4,IGF1,EDN1,GJA1,KCNE1,HMOX1,UTRN,TPM1,HCN2,HCN4,ACTC1,EMD,CNN3,	8.38E-2
GO:0055085	transmembrane transport	SLC25A30,TRPA1,MFSD10,SLC16A9,SERP1,SLC39A14,NUP160,POM121,RRBP1,ATP6V0A1,KCND1,SLC25A19,FOLR1,ABCC4,NUP210,SLC25A10,SLC25A22,SLC8A1,CLCN3,ABCC1,SLC26A7,MON2,CACNA1C,ABCB6,ABCB7,POM121C,SFXN1,TRPM6,SCN3A,ATP6V1A,HCN2,TRPM4,HCN4,ABCB5,ATP6V1E1,SEC62,SNRNP35,SLC39A3,ATP6V1B2,SEC61A1,NUP50,SLC25A1,ATP6V1C1,	8.66E-2
GO:0051240	positive regulation of multicellular organismal process	SRF,F2,BTC,EGFR,BAX,B4GALT1,OXTR,RIPK2,CCL2,GATA4,BMP7,EDN1,HSPD1,TSHR,HMOX1,TPM1,TLR4,MYOCD,HDAC2,IL6,THBS1,IL27RA,	8.81E-2
GO:0006351	transcription, DNA-dependent	FUBP1,GTF3C6,GATA3,TRPS1,POLR2I,ASH2L,GATA4,CDK9,KAT2A,CEBPA,DTX1,MKI67IP,POLR2K,ETV7,SOX5,RSF1,POLRMT,CEBPZ,PAX3,TROVE2,PIR,GTF2H1,NAT14,TRIM24,HIF3A,	9.28E-2
GO:0010629	negative regulation of gene expression	SMARCA2,YWHAQ,SIN3A,TH1L,TRPS1,CBX2,DROSHA,UBE2I,FOXP1,SNAI2,PDCD4,BCL6B,CEBPA,DRAP1,CBX5,SNX6,RSF1,ADAR,SOX9,CALR,CTBP2,CTBP1,PAX3,MOV10,BAX,HDAC4,CENPF,GLI2,PPARG,EHMT1,HSD3B7,TRIM24,MXD4,SOX6,RCOR2,NAB1,KLF4,HDAC2,	9.29E-2
GO:0015931	nucleobase, nucleoside, nucleotide and nucleic acid transport	NUP210,SLC29A1,G3BP2,NXT2,HNRNPA1L2,POM121C,NUP160,POM121,GJA1,HNRNPA1,NUP50,XPOT,SLC25A19,	9.31E-2
GO:0006333	chromatin assembly or disassembly	H3F3C,HIST2H3C,SMARCC1,HIST2H2AC,CBX2,HIST1H1B,MCM2,H3F3B,CBX5,HIST2H3D,RSF1,HIST3H3,H1FX,CHAF1B,HIST1H3B,HIST2H3A,HP1BP3,	9.38E-2
GO:0006259	DNA metabolic process	FANCI,SMARCB1,RRM1,IGF1,FOXP1,PPIA,RFC5,WDR33,UHRF1,MSH6,NT5E,MDC1,MCM4,MCM3,ANKRD17,MCM6,MCM5,MRE11A,POLA2,POLD1,MCM7,TDP1,BAX,MSH2,CENPF,RFC2,MCM2,HSPD1,HSD3B7,GTF2H1,TNKS1BP1,MYO18A,TMX1,PSIP1,CUL4B,ISG20,CHAF1B,ORC3,	9.86E-2
GO:0001763	morphogenesis of a branching structure	ERMN,SPRY2,NRP1,B4GALT1,GNA13,IGF1,GLI2,BMP7,CD44,EDN1,	9.91E-2
GO:0031497	chromatin assembly	H3F3C,HIST2H3C,HIST2H2AC,HIST1H1B,MCM2,H3F3B,HIST2H3D,RSF1,CHAF1B,HIST3H3,H1FX,HIST1H3B,HIST2H3A,HP1BP3,	9.94E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value